The amino group of adenine plays a key role in
maintaining DNA triple helical structures, being the only functional
group in DNA that is involved in both Watson-Crick and Hoogsteen
hydrogen bonds. In the present work we have probed the internal
dynamics of the adenine amino group in the intramolecular YRY triple
helix formed by the 31-mer DNA oligonucleotide
d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was
specifically labeled with 15N at the amino group of the
adenine in the fifth position. The rotation rate of the labeled amino
group was measured as a function of temperature using
1H-15N heteronuclear NMR spectroscopy. The
results indicate that, in the DNA triple helix, the rotation of the
adenine amino group is greatly slowed relative to that in a DNA double
helix. The temperature dependence of the rotation rate suggests a large
entropic contribution to this effect, which may originate from
different hydration patterns of the adenine amino group in the two structures.
 |
INTRODUCTION |
Triple-helical DNA structures are of
special interest due to their potential applications in biotechnology
and molecular medicine (Frank-Kamenetskii and Mirkin, 1995
; Plum et
al., 1995
; Radhakrishnan and Patel, 1994a
; Soyfer and Potaman, 1995
;
Vasquez and Wilson, 1998
; Wang and Feigon, 1999
). Formation of these
structures involves binding of a third DNA strand into the major groove
of a DNA double helix. The binding is highly sequence-specific. The
specificity resides, in part, in the Hoogsteen basepairing between the
nucleotides in the third strand and purines in the double-helical part
of the structure. Due to these sequence-specific interactions,
triplex-forming oligonucleotides can target unique sites in DNA, and
thus inhibit binding of proteins involved in transcriptional regulation
in vitro and in vivo (Cooney et al., 1988
; Duval-Valentin et al., 1992
;
Maher et al., 1992
; Postel et al., 1991
; Young et al., 1991
).
Triple-helical DNA structures undergo a variety of internal
conformational fluctuations that make significant contributions to
their stabilities, for example, wobbling about P
O bonds in the
phosphodiester backbone, rotation of exocyclic hydrogen bonding groups,
and basepair opening (Cain and Glick, 1998
; Laughton and Neidle, 1992
;
Powell et al., 2001
; Weerasinghe et al., 1995
). Among the groups
participating in these fluctuations, the amino group of adenine is
especially important because it is the only functional group in DNA
triple helices that is engaged in both Watson-Crick and Hoogsteen
hydrogen bonds. In T·AT triads (Fig. 1), the group forms two hydrogen bonds,
one in the Watson-Crick AT basepair, and the other in the Hoogsteen
T·A basepair. Thus, through these two hydrogen bonds, the amino group
anchors the two bases in the pyrimidine strands onto the central
purine. In the present work we have probed the conformational dynamics
of the adenine amino group using selective
15N-labeling and
1H-15N heteronuclear NMR
spectroscopy.

View larger version (21K):
[in this window]
[in a new window]
|
FIGURE 1
(A) The DNA triple helix investigated
and its folding deduced from NMR data (Macaya et al., 1992 ).
Watson-Crick basepairing is indicated by vertical bars and Hoogsteen
hydrogen bonding is indicated by asterisks. (B)
Canonical T·AT triad. The adenine amino group that was labeled with
15N is indicated.
|
|
The DNA investigated is an intramolecular triple helix formed by
the 31-mer DNA oligonucleotide shown in Fig. 1. Previous NMR studies
(Macaya et al., 1992
) have shown that, in acidic conditions, the
homopyrimidine sequence T24 through
T31 binds in the major groove of the hairpin
double helix, parallel to the homopurine sequence
A1 through A8. The
resulting structure belongs to the YRY family of triple helices, and
contains four canonical T·AT triplets
(T26·A3T18,
T28·A5T16,
T30·A7T14,
and
T31·A8T13)
and three canonical C+·GC triplets
(C25+·G2C19,
C27+·G4C17,
and
C29+·G6C15).
The first thymine in the third strand (T24) does
not form a Hoogsteen pair with A1, possibly due
to the constraints imposed by the three-base loop between the two
pyrimidine sequences (Macaya et al., 1992
). The dynamics of individual
basepairs in the same triple helix has been recently characterized by
our laboratory using proton exchange (Powell et al., 2001
). In the
present work we have labeled the DNA triple helix with
15N at the N6 amino group of the adenine in
position 5 (Fig. 1). This site-specific labeling allows observation and
characterization of the individual adenine amino group by
1H-15N-NMR methods.
 |
MATERIALS AND METHODS |
DNA samples
The DNA oligonucleotide was synthesized using
solid-support H-phosphonate chemistry on an automated DNA synthesizer
(Applied Biosystems, Foster City, CA).
15N-labeled deoxyadenosine H-phosphonate was
synthesized from 6-chloropurine as described previously (Kelly et al.,
1995
; Michalczyk et al., 1996
). The DNA oligonucleotide was purified by
reverse-phase HPLC on a PRP-1 column (Hamilton, Reno, NV) in 50 mM
triethylamine acetate buffer at pH 7.0 with a gradient of 10 to 20%
acetonitrile in 32 min. The counterions were replaced with
Na+ ions by repeated centrifugation through
Centricon YM-3 tubes (Amicon, Inc., Bedford, MA). The final
samples were in 100 mM NaCl, 5 mM MgCl2 in 90%
H2O/10% D2O. The pH of the
samples before and after the NMR measurements was 5.30 ± 0.05 (at
20°C). The samples contained ~300 O.D.260
units of DNA.
NMR methods
The NMR experiments were carried out on a Varian INOVA 500 spectrometer operating at 11.75 T and on a Varian VXR 400 spectrometer operating at 9.4 T. Regular, unedited 1H spectra
were obtained using the jump-and-return pulse sequence (Plateau and
Gueron, 1982
). 15N-edited spectra were obtained
using the 1D version of the HSQC with water flip-back pulse sequence
(Grzesiek and Bax, 1993
). The rates of rotation of the adenine amino
group were measured in transfer of magnetization experiments using the
pulse sequence that we have previously described (Michalczyk and Russu,
1997
). In this pulse sequence, each amino proton resonance is
selectively inverted using a rectangular soft pulse (4.6 ms) and,
following the delay for transfer of magnetization, the observation is
with the 1D version of the HSQC with water flip-back pulse sequence (Grzesiek and Bax, 1993
). Thirty-two values of the transfer of magnetization delay, in the range from 0.001 to 4 s, were used in
each experiment.
In the transfer of magnetization experiments used, the magnetizations
of the two amino protons (labeled A and B) depend on time as
(Michalczyk and Russu, 1999
):
|
(1)
|
where M
are the equilibrium
magnetizations, and the constant coefficients
CA,B and
FA,B depend on the relaxation rates of
the two protons and on the initial conditions of the experiment. In the
DNA triple helix investigated the longitudinal relaxation rates of the
two protons, R1A and R1B,
have similar values (e.g., 8.4 and 8.1 s
1,
respectively, at 30°C; see below). In this case, the rates
1 and
2 are
(Michalczyk and Russu, 1999
):
|
(2)
|
and
where
is the rate of cross-relaxation between the two
protons and kr is the rate of rotation
of the amino group. For each determination of the rotation rate four
sets of experimental data for the magnetization as a function of time
were used: one for each inverted proton and the other for the proton
receiving the transfer of magnetization. The rates
1 and
2 were obtained
by fitting the four sets of data simultaneously to Eq. 1 with
appropriate initial conditions (Michalczyk and Russu, 1999
).
The rate of rotation was obtained from the rates
1 and
2 based on Eqs.
2. The longitudinal relaxation rates of the two amino protons,
R1A and R1B, were
calculated using inter-proton distances derived from the canonical
structure of a YRY triple helix (Protein Data Bank 1AT4). The
cross-relaxation rate
was calculated using an inter-proton distance
of 1.75 Å. The overall correlation time of the DNA triple helix was
determined from a 1H-1H
NOESY experiment at 25°C and a magnetic field of 9.4 T. Five mixing
times in the range from 0.03 to 0.07 s were used. The initial rates of the NOESY build-up curves for cytosine H5-H6 proton pairs were
measured from the intensities of the corresponding crosspeaks normalized to the intensity of diagonal peaks at a mixing time of zero.
The obtained cross-relaxation rate (
0.74 ± 0.02 s
1) corresponds to a correlation time of
3.3 ± 0.1 ns at 25°C. The correlation time at other
temperatures was calculated from the Stokes-Einstein equation, assuming
that the viscosity of the DNA solution depends on temperature, as does
that of water (Weast, 1987
).
The time-dependence of the magnetizations of the two adenine
amino protons in transfer of magnetization experiments can be influenced by the exchange of these protons with solvent. We have measured the exchange rates of the two protons using hydrogen/deuterium exchange (from 1 to 10°C) and 15N-edited
experiments of transfer of magnetization from water (at 45°C). The
results indicated that, at these temperatures, the exchange rates of
the adenine amino protons in the DNA triple helix range from 1 × 10
4 to 0.6 s
1. These
values are at least one order of magnitude smaller than the rotation
rates (see Results). Therefore, the effect of solvent exchange in
rotation rate measurements can be neglected.
 |
RESULTS AND DISCUSSION |
The 1H-NMR spectra of the
15N-labeled DNA triple helix are shown in Fig.
2. In the unedited spectrum, the
resonances of the two adenine amino protons overlap resonances from
aromatic protons and from other amino protons. In the
15N-edited spectrum two resonances are observed,
corresponding to the two amino protons of the adenine in position 5. The chemical shift separation between these two resonances is only 0.39 ppm, as expected from the fact that both protons are involved in
hydrogen bonds (Fig. 1).

View larger version (15K):
[in this window]
[in a new window]
|
FIGURE 2
(A) Expanded region of the 1D
1H-NMR spectrum of the 15N-labeled DNA triple
helix. (B) Same spectral region in the
15N-edited 1D 1H-NMR spectrum. The vertical
scale in (B) is ~20 times higher than in
(A). Solution conditions: 100 mM NaCl, 5 mM
MgCl2 in 90% H2O/10% D2O at pH
5.3 and at 30°C.
|
|
The rotation rate of the amino group in adenine A5 was measured
as a function of temperature, in the temperature range from 30 to
45°C. Selection of this temperature range was dictated by two facts.
First, for temperatures lower than 30°C, the rotation rate is too
small to be measured accurately in transfer of magnetization experiments (i.e., kr < ~2
s
1). Second, the 1H- and
15N-NMR spectra indicated that, for temperatures
up to 45°C, the DNA molecule maintains a triple-helical structure,
and no other conformations are present in solution. The results from
measurements of rotation rates are illustrated in Fig.
3.

View larger version (16K):
[in this window]
[in a new window]
|
FIGURE 3
Time dependence of the intensities of the two adenine
amino proton resonances in transfer of magnetization experiments. For
clarity, only the data in the time range from 0.001 and 1.5 s are
shown. Filled symbols correspond to the inverted proton, open symbols
correspond to the proton receiving the transfer of magnetization.
Circles represent the intensity of the upfield resonance, rectangles
represent the intensity of the downfield resonance. The curves
represent nonlinear least-squares fits to Eq. 1.
|
|
The rotation rates were fitted as a function of temperature to the
Arrhenius equation:
|
(3)
|
where Ea is the activation energy
for rotation and A is the frequency factor (Fig.
4). The activation parameters obtained from this fit are Ea = (16 ± 2)
kcal/mol and ln A = 28 ± 3.

View larger version (11K):
[in this window]
[in a new window]
|
FIGURE 4
Temperature dependence of the rotation rate of the A5
amino group in the DNA triple helix. The full line represents the fit
of the data to Eq. 3. The dotted line represents the temperature
dependence of the rotation rate of the adenine amino groups in the DNA
double helix [d(CGCGAGCTCGCG)]2 (Michalczyk and Russu,
1999 ).
|
|
The rotation of the adenine amino groups in DNA double helices has been
previously characterized by our laboratory (Michalczyk and Russu, 1997
,
1999
). One of the DNA molecules investigated is the double helix formed
by the self-complementary 12-mer oligonucleotide 5'-d(CGCGAGCTCGCG)-3'.
The molecule contains two structurally equivalent adenines, flanked on
both 5'- and 3'-sides by guanines. This is the same sequence context as
that of the 15N-labeled adenine in the DNA triple
helix investigated (Fig. 1). The rotation rate of the adenine amino
groups and its temperature dependence in this DNA double helix are also
shown in Fig. 4 (see Note 1 at end of text). Comparison between the two
sets of results reveals that, in the DNA triple helix, the rotation of
the adenine amino group is greatly slowed relative to that in the DNA
double helix. For example, at 45°C, the rotation rate in the triplex is (6.3 ± 0.4) s
1 and that in the duplex
is 3800 s
1. One may have anticipated this
result because, in the DNA triple helix, the adenine amino group is
involved in the additional Hoogsteen hydrogen bond (Fig. 1).
Nevertheless, the activation parameters suggest that this Hoogsteen
hydrogen bond does not make a large enthalpic contribution to the
observed effect. In the DNA triple helix, the activation energy for
rotation (16 ± 2 kcal/mol) is, within experimental errors, the
same as that in the DNA double helix, namely 15.9 ± 0.2 kcal/mol
(Michalczyk and Russu, 1999
). The difference in rotation rate between
the two structures results, in large part, from a difference in the
frequency factor A: ln A = 28 ± 3 in
the DNA triple helix, and ln A = 33.5 ± 0.3 in
the DNA double helix. Therefore, a main source for the decrease in the
rotation rate in the triple helix is entropic: in this structure, formation of the activated state during rotation involves a smaller change in entropy than that in the double helix. The structural origin
of this difference cannot be rigorously described because the nature of
the activated state during rotation is not known. However, a
qualitative explanation is suggested by hydration patterns of the
adenine amino groups in DNA triple and double helices. Analysis of 14 crystallographic structures of DNA double helices in canonical B-form
has revealed that the amino group of adenine is one of the main
hydration sites (Schneider and Berman, 1995
). In the most common
hydration pattern, the amino group donates its free hydrogen to a
hydrogen bond with water. For DNA triple helices, single-crystal x-ray
structures are not available. However, hydration sites have been
defined by Patel and co-workers (Radhakrishnan and Patel, 1994b
) using
homonuclear 2D NMR methods. For YRY triple helices, no hydration sites
(i.e., sites with residence times longer than 1 ns) have been detected
in the vicinity of adenine amino groups. This result suggests that, in
DNA triple helices, the hydration at or near adenine amino groups could
be lower or the bound water molecules could be short-lived. In a DNA
double helix, rotation of the adenine amino group should break the
Watson-Crick hydrogen bond and the hydrogen bond(s) between the amino
nitrogen and water molecule(s). This disturbance of the hydration shell should increase the enthalpy and entropy changes for formation of the
activated state during rotation. In a DNA triple helix, both
Watson-Crick and Hoogsteen hydrogen bonds should break during rotation,
thus making the activation energy comparable to that in the double
helix. However, for lower hydration, the favorable contribution to the
activation entropy from bound water would be less, and the activation
entropy would therefore decrease.
In summary, in the present work we have shown that the internal
dynamics of the adenine amino group in DNA structures is not a simple
function of the number of inter-base hydrogen bonds the amino group
participates in. In DNA triple helices, formation of the Hoogsteen
hydrogen bond to the third strand also affects the rotational dynamics
of the adenine amino group through an entropic effect. Similar hydrogen
bonds from the adenine amino groups are also involved in the binding of
proteins into the major groove of DNA double helices. It will be of
interest to determine whether the local energetic changes induced at
the adenine amino group by binding of a protein follow a similar
pattern to that observed here for binding of a third DNA strand.
 |
NOTES |
1. We have attempted to measure the rotation rate of the A5
amino group under experimental conditions in which the DNA 31-mer folds
into a duplex hairpin (e.g., pH 8.0 and temperature higher than
20°C). We have found that, as in the other DNA duplexes previously investigated, the fast rotation of the adenine amino group at these
temperatures broadens the amino proton resonances beyond detection.
We thank Dr. Ryszard Michalczyk for the synthesis of the
15N-labeled deoxyadenosine H-phosphonate.
Address reprint requests to Irina M. Russu, 203 Hall-Atwater
Laboratories, Middletown, CT 06459-0175. Tel.: 860-685-2428; Fax:
860-685-2211; E-mail: irussu{at}wesleyan.edu.