| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Physics Deptartment and Molecular Biophysics Laboratory, Boston University, Boston, Massachusetts 02215
Correspondence: Address reprint requests to Kenneth J. Rothschild, Physics Dept. and Molecular Biophysics Laboratory, 590 Commonwealth Ave., Boston, MA 02215. Tel.: 617-353-2603; Fax: 617-353-5167; E-mail: kjr{at}bu.edu.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONCONCLUSIONSACKNOWLEDGEMENTSREFERENCES |
|---|
M portion of the BR photocycle. Selenomethionine was incorporated into BR using a cell-free protein translation system containing an amino acid mixture with selenomethionine substituted for methionine. BRM FTIR difference spectra recorded for unlabeled and selenomethionine-labeled cell-free expressed BR closely resemble the spectra of in vivo expressed BR. However, reproducible changes occur in two regions near 1284 and 900 cm-1 due to selenomethionine incorporation. Isotope labeled tyrosine was also co-incorporated with selenomethionine in order to confirm these assignments. Based on recent x-ray crystallographic studies, likely methionines which give rise to the FTIR difference bands are Met-118 and Met-145, which are located inside the retinal binding pocket and in a position to constrain the motion of retinal during photoisomerization. The assignment of methionine bands in the FTIR difference spectrum of BR provides a means to study methionine-chromophore interaction under physiological conditions. More generally, combining cell-free incorporations of selenomethionine into proteins with FTIR difference spectroscopy provides a useful method for investigating the role of methionines in protein structure and function. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONCONCLUSIONSACKNOWLEDGEMENTSREFERENCES |
|---|
), Ca2+-ATPase (Barth and Mantele, 1998), phytochrome (Foerstendorf et al., 2001) and photosystem I from cyanobacteria (Kim et al., 2001). This method is especially applicable to the light activated archaeal rhodopsins found in Halobacterium salinarum including bacteriorhodopsin (BR), sensory rhodopsin I and II (SRI and SRII) and halorhodopsin (HR) (Bagley et al., 1982; Bergo et al., 2000; Bousche et al., 1991; Engelhard et al., 1996; Rothschild et al., 1988; Rothschild et al., 1981; Siebert and Maentele, 1983; Walter and Braiman, 1992).
In the case of BR, a variety of bands have been assigned in FTIR difference spectra to particular amino acids, including tyrosine, threonine, aspartic acid and tryptophan residues, which undergo a structural change during the BR photocycle. Examples of assignments to specific residues include Asp-85, the Schiff base counterion/proton acceptor (Braiman et al., 1988a) and Tyr-185 (Braiman et al., 1988b), located inside the retinal binding pocket. However, most amino acids residues have not yet been assigned to bands in these spectra, even though there exists strong evidence from mutagenesis studies and x-ray crystallography that many additional residues are involved in the BR photocycle. Assignment of these bands is important because it would provide a sensitive probe of BR structural changes during each step of the photocycle, thus complementing studies using x-ray crystallography. More generally, methods to assign bands in FTIR difference spectra would impact understanding of the detailed mechanism of a wide range of proteins amenable to this spectroscopic approach.
In this work, we have focused on identification of bands in the FTIR difference spectrum arising from methionine residues which undergo a structural change during the BR photocycle. Early studies of the role of methionine residues in the BR revealed the importance of Met-118 and Met-145 for proper protein function (Greenhalgh et al., 1993). More recently, comparison of the high-resolution structures of light-adapted BR (BR570) and the M intermediate indicated that only these two methionines out of the nine present in the BR sequence undergo significant conformational changes during the BRM transition (Luecke et al., 1999a). It is therefore likely that bands are present in the BR to M FTIR difference spectrum which reflect the changes in the structure and/or environment of these residues. Such an assignment could be valuable for studying the retinal interaction with these methionines under physiological conditions using time resolved infrared methods. The assignment of methionines vibrations in bacteriorhodopsin would also help facilitate similar studies in other proteins.
A second goal of this work is to evaluate a new approach for rapid labeling of specific amino acids or combinations of amino acids in a protein for the purpose of spectroscopic studies. Conventional labeling of proteins normally involves in vivo expression in the presence of a synthetic medium containing an isotopically labeled or analog amino acid accepted by the protein translational system. However, such an approach is slow and often requires auxotrophs that cannot synthesize the unlabeled form of the amino acid. The in vivo approach is particularly difficult if more than one amino acid needs to be labeled for the purpose of spectral editing, e.g., shifting interfering bands out of a particular region of the spectrum in order to confirm the presence of other bands in the region.
We have utilized here an alternative approach based on cell-free (e.g., in vitro) protein synthesis. Previously, cell-free protein synthesis was used along with a suppressor tRNA for the purpose of site-directed isotope labeling (SDIL) of tyrosines in BR (Sonar et al., 1994). For the purpose of assigning methionine bands, selenomethionine was partially substituted for methionine in bacteriorhodopsin by using a eukaryotic cell-free translation system. Previously, this approach was utilized for determination of the crystallographic structure of the RAS protein by multi-wavelength anomalous diffraction (MAD) phasing (Kigawa et al., 2001). Selenomethionine substituted bacteriorhodopsin samples (SeMet-BR) can be rapidly expressed, isolated and reconstituted. Two bands in the BRM difference spectrum were found to undergo frequency shifts as a result of the selenomethionine substitution. The simultaneous incorporation of selenomethionine and L-tyrosine-[ring]-d4 into BR was used in order to confirm the assignment of one methionine band. The cell-free labeling approach and particularly selenomethionine to methionine substitution should be generally applicable to a wide range of proteins for the purpose of FTIR band assignment.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONCONCLUSIONSACKNOWLEDGEMENTSREFERENCES |
|---|
) was expressed using the plasmid pßH6-bOp which is derivative of pUC19 (USB, Cleveland, OH) (Messing, 1983) (see Fig. 1). The plasmid was created from a construct kindly provided by Dr. Richard Timmer containing the T7 promoter, a 57 bp 5' ß-globin UTR (ACTTGCTTTTGACACAACT GTGTTTACTTGCAATCCCCCAAAACAGACAGATAGCTT) and the bop gene. This region was removed by HindIII digestion and ligated to HindIII digested pUC19 DNA. The resulting plasmid was digested by NotI-SacI and the DNA was ligated with synthetic DNA duplex coding for hexahistidine (CATCATCACCATCACCAT), which was incorporated immediately after the last codon in the bop sequence (TCT, Ser248) and prior to the two stop codons (TGA, TAA). Successful introduction of the His6-tag was verified by dideoxy sequencing. The tag was introduced at the C terminus for convenient isolation of bacterioopsin (bOp) using Co2+ affinity column chromatography. The resulting plasmids was digested by HindIII and then transcribed with T7 polymerase using a commercial kit (mMESSAGEmMACHINE, Ambion, Inc., Austin, TX). Capped mRNA was purified by LiCl precipitation followed by ethanol precipitation.
|
Purification of in vitro produced bOp was carried out using Co2+ affinity purification resin (Talon, Clontech). 2 ml of PEG-8000, followed by 500 µl of 10% SDS and 500 µl of 1 M Tris-HCl at pH 8.0 were added to 6 ml of wheat germ translation mixture. To this solution 2 ml of the Talon resin equilibrated with 100 mM Tris-HCl, pH 8.0 was added and the suspension incubated for 20 min with gentle shaking. This mixture was then loaded on a 1 cm x 10 cm disposable column and after the resin settled washed 5 times with 1 ml of wash buffer (100 mM Tris-HCl, pH 8.0; 1% SDS). Bound bOp-His6 was eluted from the column by washing with elution buffer (wash buffer containing 200 mM imidazole). After addition of the elution buffer, 550 µl fractions were collected and 10 µl aliquots analyzed by SDS-PAGE (12%), Coomassie staining and scintillation counting.
Refolding of in vitro expressed bacteriorhodopsin
Refolding of in vitro expressed BR was based on a previously described method (Popot et al., 1987). All-trans retinal, sodium taurocholate, and buffer salts were purchased from Sigma (St. Louis, MO). Polar halobacterial lipids were prepared as described before (Popot et al., 1987). Pooled fractions of affinity purified bOp (0.8–1.0 ml) were dialyzed overnight against 500 ml of 0.5% (w/v) SDS, 50 mM NaPi (pH 6.0) using disposable Filtrasep dialysis tubes with MW cutoff of 8,000 (Midwest Scientific, St. Louis, MO). The sample was then freeze-dried, redissolved in 100 µl of distilled water and dialyzed again as described above (two buffer changes total). After dialysis to the bOp solution were added (250–300 µl final volume): 7 µl of 1% (w/v) sodium taurocholate solution in 5% (w/v) SDS, 50 mM NaPi, pH = 6.0; 20 µl of 0.5% w/v halobacterial lipids solution in 5% SDS; 50 mM NaPi pH = 6.0; and 2 µl of all-trans retinal solution (5 mM in ethanol). The resulting solution was vortexed briefly, incubated at room temperature for 15 min and then 40 µl of 4M KCl solution was slowly added. The resulting slurry was vortexed briefly and the tube was repeatedly inverted during the next 10 min. The sample was then incubated in darkness overnight at room temperature. The next day the suspension was vortexed briefly and then centrifuged at 500 rpm for 
30 s. The supernatant was collected and transferred to a new tube. The white precipitate was washed with 50 µl of dH2O, centrifuged, and the supernatant combined with the first portion. The resulting solution was then dialyzed for 4–5 days against 500 ml of 150 mM KCl, 50 mM KPi (pH = 6.0), the buffer was changed daily. The resulting solution was freeze-dried, resuspended in 100 µl of dH2O, centrifuged at 16,000 rpm for 20 min in tabletop centrifuge (Eppendorf model 5415C) and supernatant discarded. The pellet of refolded protein was resuspended in 50 µl of dH2O, vortexed, and centrifuged again (2 times).
FTIR Difference Spectroscopy
Films were prepared by depositing 10 µl of the wet pellet of the refolded in vitro expressed BR onto an AgCl window and then placing the sample in a dry-box for 1 h. Films were then rehydrated by placing 1–1.5 µl of H2O near the edge of the window and sealing the sample in a temperature-controlled IR cell (Model TFC, Harrick Scientific Corp., Ossining, NY) using a second AgCl window. Spectra were recorded as previously reported at -20°C and 2 cm-1 resolution (Roepe et al., 1987) with a Bio-Rad FTS-60A FTIR spectrometer (Bio-Rad, Digilab Division, Cambridge, MA) using a liquid nitrogen cooled MCT detector. A Dolan-Jenner (Woburn, MA) model 180 illuminator (150 W, tungsten-halogen) and a fiber-optic light guide were used for sample illumination in combination with a long pass 
max > 505 nm filter (Corion Corp., Holliston, MA). Spectra were typically recorded of the sample in the dark and light for 1400 scans each and the absorption difference computed. At least 20 absorption difference spectra are recorded and averaged to obtain the final difference spectrum.
|
RESULTS AND DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONCONCLUSIONSACKNOWLEDGEMENTSREFERENCES |
|---|
).
As seen in Fig. 2, bOp is produced in the wheat germ extract, even in the absence of exogenously added methionine. This indicates that the wheat germ extract contains methionine either in a free form or as Met-tRNAMet. The synthesis of bOp increases twofold above this basal level with increasing concentrations of exogenous methionine up to 100–200 µM, with a slight decrease observed at higher concentrations (Fig. 2). Note that at the highest concentration (2000 µM) (Fig. 2, inset) substitution of selenomethionine for methionine in the reaction mixture had minimal effect on the yield of bOp. This agrees well with previously published results on selenomethionine substitution in a cell-free produced Ras (Kigawa et al., 2001). On this basis, we conclude that selenomethionine is accepted almost as well as methionine by the in vitro translation system. Since the overall yield of bOp is twofold higher above basal level when SeMet is added, the SeMetMet substitution should be at least 50%. However, SeMet incorporation is likely to be higher since the endogenous methionine which accounts for protein synthesis when no external methionine (or selenomethionine) is added, will be diluted by the selenomethionine added to the reaction mixture. Importantly, as discussed below, this level of incorporation is sufficient to detect alterations in the FTIR difference spectra.
|
26 kDa. Similarly, a single band corresponding to SeMet-BR appears at a slightly higher position due to the presence of the additional His6-tag.
|
M difference spectra of in vitro expressed BR (WT) (bottom trace), and the selenomethionine containing in vitro expressed BR (SeMet-BR) (top trace) in two regions of the spectrum from 1800–1400 cm-1 (panel A) and 1400–1000 cm-1 (panel B). Previous studies of BR have shown that FTIR difference spectroscopy is highly sensitive to the conformational changes that occur during the BRM transition (Rothschild and Sonar, 1995). Even small perturbations in the pattern of hydrogen bonding changes, which occur on a local level (e.g., individual side chains), should be detectable in the difference spectrum.
|
SeMet substitution has very little effect on the normal structural changes occurring in the BR photocycle. For example, no effects are seen in the carboxylic acid (C
O) Asp/Glu stretching region (1800–1700 cm-1), amide I region (1700–1600 cm-1) (Parker, 1983), the ethylenic CC stretch region of the retinylidene chromophore reflecting the shift from light adapted BR (1527 cm-1 (-)) to the M intermediate (1567 cm-1 (+)) and the chromophore fingerprint region (1254 (-), 1201 (-), 1168 (-) cm-1) (Smith et al., 1987). Bands assigned to particular amino acids are equally unaffected. Examples include peaks due to Asp-85 at 1761 cm-1 (+), Asp-96 at 1742 cm-1 (-) (Braiman et al., 1988a; Maeda et al., 1992b), Tyr-185 at 1276 cm-1 (-) and 1271 cm-1 (+) (Braiman et al., 1988b; Roepe et al., 1987; Rothschild et al., 1986), Thr-89 near 1125 cm-1 (Liu et al., 1998); and Trp in the 740 cm-1 region (Roepe et al., 1988) and at 3486 cm-1 (Maeda et al., 1992a) (data not shown). The vibrational bands assigned to at least one water molecule, most likely located in the active site of BR (Brown et al., 1994), are also not altered by the SeMet substitution (data not shown).
Despite the similarity between the FTIR difference spectra of SeMet-BR and WT BR, we observe a reproducible change of a negative band appearing at 1284 cm-1 in WT BR which is absent in SeMet-BR (Fig. 4 B). This region has been previously associated with structural changes in the protonation state of tyrosine. In particular, the 1276 (-) and 1271 (+) cm-1 bands were assigned to alterations in the environment of a tyrosine on the basis of in vivo amino acid substitution of L-tyrosine-[ring]-d4 for normal L-tyrosine (Roepe et al., 1987; Rothschild et al., 1986). Site-directed mutagenesis (Braiman et al., 1988b) and site-directed isotope labeling (Liu et al., 1995) further demonstrated that these bands arise from Tyr185.
To confirm that the spectral change at 1284 cm-1 was solely due to the MetSeMet substitution, we spectrally edited this region to remove interference from tyrosine bands. This was accomplished by substituting Tyr with L-tyrosine-[ring]-d4 (D4-Tyr-BR) both for normal and SeMet substituted BR (see Materials and Methods). Spectral changes induced by L-tyrosine-[ring]-d4 substitution (second trace from top, Fig. 5) agree closely with previous studies using in vivo substitution of tyrosine and include almost complete disappearance of the bands at 1276 cm-1 (-) and 1271 cm-1 (+) (Roepe et al., 1987). This result indicates that in vitro L-tyrosine-[ring]-d4 substitution is highly efficient.
|
M portion of the photocycle. There is some evidence that this band upshifts in frequency to the 1310-1320 cm-1 region due to MetSeMet substitution, which is indicated by a small downshift in frequency of a strong band located near 1320 cm-1 to near 1318 cm-1 for both the case of D4-Tyr/SeMet-BR and SeMet-BR. A second reproducible spectral change is observed in both BR and D4-Tyr-BR at 899 cm-1 (-). This negative band disappears (Fig. 6) and is accompanied by a drop in intensity of a positive peak near 903 cm-1. A possible explanation is that SeMet substitution causes the 899 cm-1 band to upshift 3–4 cm-1. We also note that it is possible that upon M formation a shift in frequency occurs for both methionine assigned negative bands at 1284 and 899 cm-1 giving rise to positive bands elsewhere in the spectrum. However, since we have not identified such positive components, the most likely explanation is that both these bands undergo primarily a change in intensity.
|
; Tamba et al., 1973), revealed that the SSe substitution had a small effect on the 1800–1400 cm-1 region but altered many peaks below 1400 cm-1. The latter bands represent various vibrational modes of the methionine side chain and typically have medium intensity (Grunenberg and Bougeard, 1986). Because our difference spectra exhibited only two bands at 1284 and 903/899 cm-1, which are sensitive to the SSe replacement, it appears that only minor alterations of the chemical bonds involving sulfur occur during the BRM transition. While assignment of these bands to particular vibrational modes of methionine is not possible based on the current data, one infrared study of solid methionine (Grunenberg and Bougeard, 1987) observed bands at similar frequencies (1276 and 921 cm-1) (intensities not given), which were assigned to predominantly S-C-H bending modes. Alternatively, the 1284 cm-1 peak may arise from the mixed CH3-deformation and S-C-H bending vibration observed between 1311–1318 cm-1 (Grunenberg and Bougeard, 1987; Tamba et al., 1973). This band shifts to 1345 cm-1 upon substitution with selenium (Tamba et al., 1973), which would be consistent with the possible 36 cm-1 upshift of the 1284 cm-1 band. |
CONCLUSIONS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONCONCLUSIONSACKNOWLEDGEMENTSREFERENCES |
|---|
10 µg of purified, refolded BR, sufficient to obtain high quality FTIR difference spectra. Utilization of dialysis methods of cell-free protein translation should produce even higher yields and higher levels of isotope/analog amino acid incorporation (Kigawa et al., 2001).
Our results indicate that one or more methionines undergo structural changes during the BR photocycle. An important question is the identity of those specific methionine residue(s), which give rise to the methionine assigned bands. Studies based on site-directed mutagenesis by Khorana and coworkers (Greenhalgh et al., 1993) revealed that two methionines, Met-118 and Met-145, are important for proper BR folding, max and photocycle behavior of BR.
More recently, high-resolution x-ray crystallography has revealed the location of methionines that undergo structural changes during the BR photocycle (Luecke et al., 1999a; Luecke et al., 1999b). As was predicted by mutagenesis studies, Met-118 is located in the retinylidene binding site and interacts directly with the C9-methyl group of retinal, while Met-145 is located on helix E and near the retinal ß-ionone ring of the chromophore. Analysis of the crystal structures of the light-adapted and M photointermediate states using protein data bank (PDB) coordinate files 1C8R and 1C8S (Luecke et al., 1999a), shows that only these two methionines experience a noticeable structural change during the BRM transition. The largest changes occur in Met-118 where the side chain adopts a different conformation causing the displacement of the terminal methyl group by more than 2 Å from its ground state position. Residues near the ß-ionone ring including Met-145 experience only minor alterations that result from a small (0.4 Å) movement of this part of the chromophore after isomerization (Luecke et al., 1999a). Therefore the appearance of vibrational features associated with methionine in the BRM difference spectra could be explained by the changes in the conformation of methionine side chain(s) observed in the x-ray studies. Note that significant perturbations of methionine groups occur only in the late M (MN) intermediate, which is presumably formed under conditions of our experiment (steady-state illumination at -20°C). In contrast the structure of the early M state 1KG8 (Facciotti et al., 2001) obtained at lower temperature (230 K) exhibited much smaller protein changes. Similarly, the structure of the early K intermediate (PDB 1QKP) did not show any changes of Met-118 or Met-145, although a small movement of Met-20 side chain in response to the chromophore isomerization was observed (Edman et al., 1999).
In conclusion, by using cell-free amino acid substitution, it should be possible to quickly assign bands in the FTIR difference spectrum of many proteins. For example, once a protein can be expressed and purified in a cell-free system, it is relatively simple to introduce a variety of amino acid mixtures containing single amino acid isotope labels or amino acid analogs such as selenomethionine. This may be especially valuable in the case of proteins that are normally expressed in insect cell cultures (Sf9) or mammalian cell cultures, where isotope labeling is more difficult to achieve.
|
ACKNOWLEDGEMENTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONCONCLUSIONSACKNOWLEDGEMENTSREFERENCES |
|---|
The work was supported by a grant from the National Eye Institute (EY05499).
Submitted on June 18, 2002; accepted for publication October 8, 2002.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONCONCLUSIONSACKNOWLEDGEMENTSREFERENCES |
|---|
Barth, A., and W. Mantele. 1998. ATP-Induced phosphorylation of the sarcoplasmic reticulum Ca2+ ATPase: molecular interpretation of infrared difference spectra. Biophys. J. 75:538–544.
Bergo, V., E. N. Spudich, K. L. Scott, J. L. Spudich, and K. J. Rothschild. 2000. FTIR analysis of the SII540 intermediate of sensory rhodopsin II: Asp73 is the Schiff base proton acceptor. Biochemistry. 39:2823–2830.[Medline]
Bousche, O., E. N. Spudich, J. L. Spudich, and K. J. Rothschild. 1991. Conformational changes in sensory rhodopsin I: similarities and differences with bacteriorhodopsin, halorhodopsin, and rhodopsin. Biochemistry. 30:5395–5400.[Medline]
Braiman, M. S., T. Mogi, T. Marti, L. J. Stern, H. G. Khorana, and K. J. Rothschild. 1988a. Vibrational spectroscopy of bacteriorhodopsin mutants: light-driven proton transport involves protonation changes of aspartic acid residues 85, 96, and 212. Biochemistry. 27:8516–8520.[Medline]
Braiman, M. S., T. Mogi, L. J. Stern, N. R. Hackett, B. H. Chao, H. G. Khorana, and K. J. Rothschild. 1988b. Vibrational spectroscopy of bacteriorhodopsin mutants. I. Tyrosine-185 protonates and deprotonates during the photocycle. Proteins. 3:219–229.[Medline]
Brown, L. S., Y. Gat, M. Sheves, Y. Yamazaki, A. Maeda, R. Needleman, and J. K. Lanyi. 1994. The retinal Schiff base-counterion complex of bacteriorhodopsin: changed geometry during the photocycle is a cause of proton transfer to aspartate 85. Biochemistry. 33:12001–12011.[Medline]
Edman, K., P. Nollert, A. Royant, H. Belrhali, E. Pebay-Peyroula, J. Hajdu, R. Neutze, and E. M. Landau. 1999. High-resolution X-ray structure of an early intermediate in the bacteriorhodopsin photocycle. Nature. 401:822–826 [see comments].[Medline]
Engelhard, M., B. Scharf, and F. Siebert. 1996. Protonation changes during the photocycle of sensory rhodopsin II from Natronobacterium pharaonis. FEBS Lett. 395:195–198.[Medline]
Facciotti, M. T., S. Rouhani, F. T. Burkard, F. M. Betancourt, K. H. Downing, R. B. Rose, G. McDermott, and R. M. Glaeser. 2001. Structure of an early intermediate in the M-state phase of the bacteriorhodopsin photocycle. Biophys. J. 81:3442–3455.
Foerstendorf, H., C. Benda, W. Gartner, M. Storf, H. Scheer, and F. Siebert. 2001. FTIR studies of phytochrome photoreactions reveal the CO bands of the chromophore: consequences for its protonation states, conformation, and protein interaction. Biochemistry. 40:14952–14959.[Medline]
Greenhalgh, D. A., D. L. Farrens, S. Subramaniam, and H. G. Khorana. 1993. Hydrophobic amino acids in the retinal-binding pocket of bacteriorhodopsin. J. Biol. Chem. 268:20305–20311.
Grunenberg, A., and D. Bougeard. 1986. The observed and calculated vibrational spectra of DL-methionine in the study of the solid state phase transition. Ber. Bunsenges. Phys. Chem. 90:485–492.
Grunenberg, A., and D. Bougeard. 1987. Vibrational spectra and conformational phase transition of crystalline L-methionine. J. Mol. Struct. 160:27–36.
Kigawa, T., E. Yamaguchi-Nunokawa, K. Kodama, T. Matsuda, T. Yabuki, N. Matsuda, R. Ishitani, O. Nureki, and S. Yokoyama. 2001. Selenomethionine incorporation into a protein by cell-free synthesis. J. Struct. Funct. Genomics. 2:27–33.
Kim, S., C. A. Sacksteder, K. A. Bixby, and B. A. Barry. 2001. A reaction-induced FT-IR study of cyanobacterial photosystem I. Biochemistry. 40:15384–15395.[Medline]
Liu, X., M. J. Lee, M. Coleman, P. Rath, A. Nilsson, W. B. Fischer, M. Bizounok, J. Herzfeld, W. F. Karstens, J. Raap, J. Lugtenburg, and K. J. Rothschild. 1998. Detection of threonine structural changes upon formation of the M- intermediate of bacteriorhodopsin: evidence for assignment to Thr-89. Biochim. Biophys. Acta. 1365:363–372.[Medline]
Liu, X.-M., S. Sonar, C.-P. Lee, M. Coleman, U. L. Rajbhandary, and K. J. Rothschild. 1995. Site-directed isotope labeling and FTIR spectroscopy: Assignment of tyrosine bands in the bR
M difference spectrum of bacteriorhodopsin. Biophys. Chem. 56:63–70.[Medline]
Luecke, H., B. Schobert, H. T. Richter, J. P. Cartailler, and J. K. Lanyi. 1999a. Structural changes in bacteriorhodopsin during ion transport at 2 angstrom resolution. Science. 286:255–261.
Luecke, H., B. Schobert, H. T. Richter, J. P. Cartailler, and J. K. Lanyi. 1999b. Structure of bacteriorhodopsin at 1.55 A resolution. J. Mol. Biol. 291:899–911.[Medline]
Maeda, A., J. Sasaki, Y. J. Ohkita, M. Simpson, and J. Herzfeld. 1992a. Tryptophan perturbation in the L intermediate of bacteriorhodopsin: fourier transform infrared analysis with indole-15N shift. Biochemistry. 31:12543–12545.[Medline]
Maeda, A., J. Sasaki, Y. Shichida, T. Yoshizawa, M. Chang, B. Ni, R. Needleman, and J. K. Lanyi. 1992b. Structures of aspartic acid-96 in the L and N intermediates of bacteriorhodopsin: analysis by Fourier transform infrared spectroscopy. Biochemistry. 31:4684–4690.[Medline]
Messing, J. 1983. New M13 vectors for cloning. Methods Enzymol. 101:20–78.[Medline]
Mogi, T., L. J. Stern, N. R. Hackett, and H. G. Khorana. 1987. Bacteriorhodopsin mutants containing single tyrosine to phenylalanine substitutions are all active in proton translocation. Proc. Natl. Acad. Sci. USA. 84:5595–5599.
Parker, F. S. 1983. Applications of infrared, Raman and resonance Raman spectroscopy in biochemistry. Plenum Press, New York. 550.
Popot, J. L., S. E. Gerchman, and D. M. Engelman. 1987. Refolding of bacteriorhodopsin in lipid bilayers. A thermodynamically controlled two-stage process. J. Mol. Biol. 198:655–676.[Medline]
Promega. 1996. Protein Translation In Vitro. Protocols and Application Guide, 3rd ed. Promega Corp., Madison. 261–276.
Roepe, P., P. L. Ahl, S. K. Das Gupta, J. Herzfeld, and K. J. Rothschild. 1987. Tyrosine and carboxyl protonation changes in the bacteriorhodopsin photocycle. 1. M412 and L550 intermediates. Biochemistry. 26:6696–6707.[Medline]
Roepe, P., D. Gray, J. Lugtenburg, E. M. M. van den Berg, J. Herzfeld, and K. J. Rothschild. 1988. FTIR Evidence for Tryptophan Perturbations during the Bacteriorhodopsin Photocycle. J. Am. Chem. Soc. 110:7223–7224.
Rothschild, K. J., O. Bousché, M. S. Braiman, C. A. Hasselbacher, and J. L. Spudich. 1988. Fourier transform infrared study of the halorhodopsin chloride pump. Biochemistry. 27:2420–2424.[Medline]
Rothschild, K. J., P. Roepe, P. L. Ahl, T. N. Earnest, R. A. Bogomolni, S. K. Das Gupta, C. M. Mulliken, and J. Herzfeld. 1986. Evidence for a tyrosine protonation change during the primary phototransition of bacteriorhodopsin at low temperature. Proc. Natl. Acad. Sci. USA. 83:347–351.
Rothschild, K. J., and S. Sonar. 1995. Bacteriorhodopsin: New biophysical perspectives. In CRC handbook of organic photochemistry and photobiology. Horspool WM and P-S. Song, editors. CRC Press, Inc, London. 1521–1544.
Rothschild, K. J., M. Zagaeski, and W. A. Cantore. 1981. Conformational changes of bacteriorhodopsin detected by Fourier transform infrared difference spectroscopy. Biochem. Biophys. Res. Commun. 103:483–489.[Medline]
Shepherd, L., and R. E. Huber. 1969. Some chemical and biochemical properties of selenomethionine. Can. J. Biochem. 47:877–881.[Medline]
Siebert, F., and W. Maentele. 1983. Investigation of the primary photochemistry of bacteriorhodopsin by low-temperature Fourier-transform infrared spectroscopy. Eur. J. Biochem. 130:565–573.[Medline]
Smith, S. O., M. S. Braiman, A. B. Myers, J. A. Pardoen, J. M. L. Courtin, C. Winkel, J. Lugtenburg, and R. A. Mathies. 1987. Vibrational analysis of the all-trans-retinal chromophore in light-adapted bacteriorhodopsin. J. Am. Chem. Soc. 109:3108–3125.
Sonar, S., C. P. Lee, M. Coleman, N. Patel, X. Liu, T. Marti, H. G. Khorana, U. L. Rajbhandary, and K. Rothschild. 1994. Site-directed isotope labelling and FTIR spectroscopy of bacteriorhodopsin. Nat. Struct. Biol. 1:512–517.[Medline]
Tamba, M., B. Righetti, and R. Badiello. 1973. The uv and ir spectra of thio- and selenoamino acids. Atti Ist. Veneto Sci., Lett. Arti. Classe di Scienze Matematiche e Naturali. 131:105–118.
van Thor, J. J., A. J. Pierik, I. Nugteren-Roodzant, A. Xie, and K. J. Hellingwerf. 1998. Characterization of the photoconversion of green fluorescent protein with FTIR spectroscopy. Biochemistry. 37:16915–16921.[Medline]
Walter, T. J., and M. S. Braiman. 1992. FTIR difference spectroscopy of halorhodopsin in the presence of different anions. In Structure and Functions of Retinal Proteins. Rigaud JL, editor. 233–236.
This article has been cited by other articles:
 |
|
 |
|
  V. B. Bergo, E. N. Spudich, K. J. Rothschild, and J. L. Spudich Photoactivation Perturbs the Membrane-embedded Contacts between Sensory Rhodopsin II and Its Transducer J. Biol. Chem., August 5, 2005; 280(31): 28365 - 28369. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Bergo, E. N. Spudich, J. L. Spudich, and K. J. Rothschild Conformational Changes Detected in a Sensory Rhodopsin II-Transducer Complex J. Biol. Chem., September 19, 2003; 278(38): 36556 - 36562. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
