| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |




Eidgenössische Technische Hochschule Zürich, * Institut für Mikrobiologie,
Institut für Physikalische Chemie, CH-8092 Zürich, Switzerland
Correspondence: Address reprint requests to Peter Dimroth, E-mail: dimroth{at}micro.biol.ethz.ch.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
pNa+/
pH), which is in part generated by the oxaloacetate decarboxylase Na+ pump, a key enzyme of citrate fermentation in K. pneumoniae (Dimroth, 1997
Single-molecule spectroscopy has developed to a powerful tool to investigate biological systems (Weiss, 1999
). This method has distinct advantages over conventional ensemble spectrophotometric studies, e.g., much higher sensitivity, the possibility to discriminate between static and dynamic quenching in a single experiment, or direct observation of binding events by colocalization studies (Schutz et al., 1998
). Inherently single-molecule experiments are free from unwanted interactions between proteins due to high-concentration artifacts. Recently, fluorescence quenching has been used to study protein folding (Zhuang et al., 2000
) and conformational heterogeneities of membrane proteins (Peleg et al., 2001
). We now used fluorescence quenching of single molecules to get further insights into the role of loop X-XI in the citrate translocation mechanism of CitS. Our results show that single-molecule fluorescence studies can be used to examine functional conformational changes in membrane proteins, specifically in transporters. In a second part, single-molecule studies with dual-color labeling allowed us to report on the oligomerization state of CitS.
| MATERIALS AND METHODS |
|---|
|
|
|---|
(Bethesda Research Laboratories, Frederick, MD) and plasmid pFXa3 (Kaestner et al., 2000
Construction of single-Cys mutants
The CitS single-Cys mutants were constructed by polymerase chain reaction (PCR) mutagenesis using the two-step method described by Weiner et al. (1994)
. Four of the five native cysteines (C278, C317, C347, C398, C414) were subsequently replaced with serines resulting in the two CitS single-Cys mutants CitS-sC398 and CitS-sC414. For each mutation, two complementary mutagenic oligonucleotide primers were synthesized containing the desired mutation (indicated by boldface type) and a unique restriction site (underlined and specified in parentheses) to facilitate mutant identification (only the forward primers are shown):
C278S: GGTGCTGTCCACTACAAGCTTCCTGCTGGCC (HindIII)
C317S: CCTCCGGGCTGAGCTCACCGGAAATC (SacI)
C347S: GGGGTCGGCGTCAGCTACACAGATCTACAGGAAATTA-TC (BglII)
C398S: CACTGCAGGCCTGTCCATGGCCAACCGC (NcoI)
C414S: CCTGGAAGTTCTCTCTGCTAGCAACCGTATGAACCTTA-TCTC (NheI)
The mutagenic PCRs for CitS-sC398 (CitS-sC414) were performed in the following order: C278S
C317S
C347S
C414S (C398S). In addition, a Cys-less mutant was constructed by replacing even the last remaining cysteine residue with serine (CitS-C-less). After each PCR the methylated nonmutated parental DNA was digested with DpnI and 2 µl of the reaction were transformed into E. coli DH5
by electroporation (Holo and Nes, 1989
). Mutated DNA was identified by the acquisition of the new restriction site and sequenced by using the dideoxy chain termination method (Sanger et al., 1977
) to ensure that no other mutations occurred during the amplification process. For expression and purification the mutagenized citS genes in pFXa3 were cloned into pCitSH3 comprising an N-terminally attached 10x polyhistidine tag. Therefore the pFXa3 plasmids were digested with BamHI to produce 1.36 kb fragments carrying the mutagenized citS gene (citS*). Then the BamHI fragment of pCitSH3 was replaced by the mutagenized citS fragments resulting in pCitSH3(sC398), pCitSH3(sC414), and pCitSH3(C-less). Again, the DNA sequence of the ligated fragments was confirmed by sequencing.
Expression and purification of the mutant proteins
For expression and purification of the His-tagged fusion proteins, essentially the same protocol was used as described earlier (Kaestner et al., 2000
). For the final Ni2+ affinity chromatography we used a Poros MC20 column (4.6 x 100 mm, PerSeptive Biosystems, Foster City, CA) operated on a BioCAD workstation (PerSeptive Biosystems, Foster City, CA) with ultraviolet (UV) detection at 280 nm. The Triton X-100 extract of the membrane vesicles was applied to the column preequilibrated with 10 column volumes of buffer C (50 mM potassium phosphate, 100 mM potassium chloride, 0.5 mM imidazole, 10% (v/v) glycerol, 0.05% (w/v) n-dodecyl-ß-D-maltoside, pH 7.0). The column was washed with a linear gradient of 0.5180 mM imidazole in 10 column volumes buffer C followed by 10 column volumes of buffer C containing 180 mM imidazole. The fusion proteins were eluted with buffer C containing 500 mM imidazole. The flow rate was 10 ml/min and 1 ml fractions were collected. The fractions containing the purified protein were pooled and concentrated by ultrafiltration using Centricon YM-30 centrifugal filter devices (Amicon, Danvers, MA). To remove imidazole, the samples (2 ml) were dialyzed twice for 6 h at 4°C in 500 ml buffer C using SpectraPor regenerated cellulose membranes (25 kD MWCO, Spectrum Laboratories, Rancho Dominguez, CA).
Reconstitution and transport experiments
The purified proteins were reconstituted using the freeze/thaw/sonication procedure as described previously (Pos and Dimroth, 1996
). For transport experiments the proteoliposomes (2 µl) prepared in buffer R (50 mM potassium phosphate, pH 7.5) were diluted into 98 µl of buffer A (50 mM sodium phosphate, pH 6.0) containing 12 µM of [1,5-14C]citrate (180220 cpm/pmol). The transport assays were terminated according to a time scale (0120 s) by the addition of 0.9 ml of ice-cold 0.1 M LiCl and rapid filtration through 0.22 µm filters (GSTF, Millipore, Bedford, MA). The filters were washed once with 1 ml of ice-cold 0.1 M LiCl and inserted into wells of a Picoplate (24-well, Canberra Packard). After the addition of 1 ml Microscint-20 (Canberra Packard, Pangbourne, UK), the entrapped [1,5-14C]citrate was determined by liquid scintillation counting on a Microplate scintillation counter (TopCount, Canberra Packard, Pangbourne, UK). Initial rates were determined by the same procedure, but the reaction was immediately stopped after 5 s incubation time.
Labeling with AF546 and AF568
To obtain fluorophore-conjugated CitS, 5 µl of Alexa Fluor 546 C5 maleimide (AF546, Molecular Probes, Leiden, The Netherlands) stock solution (800 µM) in 50 mM potassium phosphate buffer (pH 7.0) were added to 100 µl of purified and concentrated CitS-sC398 or CitS-sC414 (40 µM) and incubated in a thermomixer (Eppendorf, Hamburg, Germany) for 10 min at 25°C in the dark. The reaction was stopped by passage through two centrifuge columns (1 ml, Sephadex G-25 medium) to separate labeled CitS from unreacted fluorophore. The degree of labeling was calculated by measuring the absorption of the fluorophore protein conjugate using a molar extinction coefficient of 92,000 M-1 cm-1 at 575 nm (Molecular Probes, Leiden, The Netherlands) and applying the Beer-Lambert law. For dual-color labeling a stock solution containing equimolar concentrations (800 µM) of Alexa Fluor 568 C5 maleimide (AF568, Molecular Probes, Leiden, The Netherlands) and Alexa Fluor 546 C5 maleimide (AF546) was used. The labeled protein was stored under liquid nitrogen.
SDS-PAGE and BN-PAGE analysis
The fluorophore attachment of fluorophore-protein conjugates was verified by SDS polyacrylamide gel electrophoresis using a 15% separating gel (Laemmli and Faure, 1973
). The SDS-PAGE gel was first illuminated at 366 nm and then stained with Coomassie Blue G250.
The Blue Native PAGE analysis of wild-type CitS and CitS-sC398 was performed as described by Schägger and Jagow (1991)
. The purified samples (25 µg) were applied to a 515% gradient polyacrylamide gel with a 4% stacking gel and subjected to electrophoresis at 4°C. Immediately after electrophoresis, the gel was stained with Coomassie Blue G250.
Ni-NTA coating of cover glasses
The glass surface was coated with Ni-NTA using a modified procedure described by Adachi et al. (2000)
. The cover glasses (24 x 24 mm, Menzel, Braunschweig, Germany) were precleaned by baking at 500°C for 2 h. Successively, the glasses were incubated in sealing solution (2% (v/v) 3-glycidyloxypropyl-trimethoxysilane (Fluka, Buchs, Switzerland), 0.01% (v/v) acetic acid) for 3 h at 90°C; coating solution (2% (w/v) N,N-bis(carboxymethyl)-L-lysine (Fluka, Buchs, Switzerland), 2 mM KHCO3, pH 10.0) for 16 h at 60°C; and Ni2+ solution (10 mM NiSO4, 5 mM glycine, pH 8.0) for at least 2 h at room temperature. After each coating step the glasses were washed with ultrapure water.
Sample preparation
For each series of measurements aliquots of labeled CitS-sC398 were thawed and diluted to a concentration of 30 nM in buffer F (50 mM potassium phosphate, 100 mM potassium chloride, 0.05% n-dodecyl-ß-D-maltoside, pH 7.0). A Ni-NTA coated cover glass was attached to the piezo scan stage and covered with 60 µl of buffer F. Upon addition of 2 µl His-tagged CitS or fluorescent derivatives (30 nM), the proteins become immobilized. In the case of fluorescence quenching studies, 5 µl of citrate or Na+ in buffer F in various concentrations was added.
Scanning confocal fluorescence microscopy
The measurements were performed using a home built scanning confocal fluorescence microscope (Prummer et al., 2000
). A scheme of the set up is shown in Fig. 1. A pulsed frequency-doubled Nd:YAG laser (Antares; Coherent, Santa Clara, CA) was used to excite the fluorophores. The polarization was controlled by a polarizer, an electrooptical modulator, an analyzer, and a quarter- or a half-wave plate. To achieve a Gaussian beam profile, the light was spatially filtered by an optical fiber. Thereafter, the light was reflected by a dichroic (540DRLP, Omega, Brattleboro, VT) and an ordinary mirror into a high numerical aperture objective lens (Planapo 60x, NA 1.4; Nikon, Tokyo, Japan) resulting in a diffraction limited excitation spot (full-width at half maximum
250 nm). A confocal fluorescence image was built up by scanning the sample with the piezo stage pixel-by-pixel through the excitation volume while counting the fluorescence photons at each point.
|
From the absolute time when a photon was detected, the intensity was calculated for each channel (I1, I2, I3) with variable integration time. The dichroic ratio
![]() | 1 |
![]() | 2 |
| RESULTS |
|---|
|
|
|---|
Single-Cys mutants CitS-sC398 and CitS-sC414
CitS has two endogenous cysteine residues (C398, C414) in the particularly interesting loop X-XI region, which could be used as targets for the binding of the thiol-reactive fluorophores (Fig. 2). However, as five cysteines are present in CitS, single cysteine mutants had first to be created genetically to achieve specific labeling of only a single cysteine residue. With this goal in mind we replaced the five cysteines step-by-step with serine and determined the citrate transport activity of the carrier after each step. Fortunately, all cysteine/serine substitutions were tolerated because the E. coli transformants expressing the various citS mutants (DH5
/pFXa3-citS*) were all able to grow on Simmons' citrate agar as recognized by a color change of the pH indicator bromthymol blue due to alkalinization of the medium. All citrate carriers containing cysteine substitutions were confirmed to be functional by [1,5-14C]citrate uptake into the E. coli cells expressing the CitS mutants. For a more quantitative assessment of the citrate transport activities of particularly interesting mutants, the N-terminally His-tagged fusion proteins CitS-sC398, CitS-sC414, and CitS-C-less were expressed, purified, and reconstituted into proteoliposomes.
|
|
80% for both conjugates. Thus, the region comprising C398 and C414 must be accessible to this rather hydrophilic fluorophore. The effect of the bound fluorescent probe on the activity of the conjugates was again investigated by [1,5-14C]citrate uptake studies with CitS-sC3981 and CitS-sC4141 reconstituted into proteoliposomes (Fig. 3). The initial transport rate of the conjugate CitS-sC3981 (98 nmol mg-1 min-1) was only slightly reduced compared to the nonmodified protein CitS-sC398 (109 nmol mg-1 min-1) and showed almost the same kinetic pattern (Fig. 5). This suggested that the bound fluorophore at position 398 did not affect imperative interactions during citrate translocation or result in partial inactivation. In contrast, with conjugate CitS-sC4141 a complete loss of transport activity was observed. Most likely, the bound probe AF546 at position 414 blocks citrate binding or inhibits mandatory interactions during the transport process. Therefore, we decided to concentrate our studies on the functional conjugate CitS-sC3981.
|
|
For the single-molecule studies His-tagged CitS-sC3981 was immobilized on a Ni-NTA coated cover glass and subsequently fluorescence images were recorded with an integration time of 1 ms per pixel. The same frame (10 µm x 10 µm) was recorded twice to show the effect of bleaching and additional binding/unbinding of CitS-sC3981 to the glass surface, leading to vanishing and emerging spots, respectively (Fig. 5). Some of the spots moved laterally and indicated partial mobility of conjugates but the majority of bright spots did not change significantly. However, the addition of 250 µM citrate caused strong static quenching of AF546 at position 398, whereas the addition of 250 µM DL-isocitrate, that served as a control, did not alter the fluorescence emission of the bound probe (Fig. 6).
|
|
|
20 times higher than the apparent affinity of wild- type CitS for sodium ions (K0.5 = 2.7 mM) (Kaestner et al., 2000
Dual-color labeling and detection studies with CitS-sC3982
The fluorescence intensity of a number of spots showed strong and irregular variations, usually not seen with single molecules. They could be explained by the existence of CitS oligomers with two or more fluorophores at a distance of 4 nm or less. Fluorescence homotransfer together with some rotational degree of freedom and intersystem crossing could be responsible for the fluctuating intensity. Indeed, there was preliminary evidence for a dimeric arrangement of CitS in detergent micelles and lipid membranes. Such evidences derived from affinity chromatography, where the CitS fusion protein eluted as heterodimer because of a mixed population of a tagged and a nontagged form (purification tag cleaved off) (Pos et al., 1994
). Recent blue native PAGE experiments in our lab correspond with these findings because purified wild-type CitS as well as CitS-sC398 showed an electrophoretic mobility of the homodimeric form (
100 kDa) (Fig. 4 C).
Because single-molecule experiments, in contrast to ensemble measurements by UV/VIS spectrophotometry, allow us to identify heterogeneities or different classes in a population, they can be used to study the state of protein-protein interaction. For this purpose, we performed a dual-color labeling and detection experiment with immobilized CitS-sC398-AF546/568 (CitS-sC3982). Due to our equimolar labeling procedure with the two different Alexa Fluor derivatives AF546 and AF568 and
80% degree of labeling, the following dual-labeled dimeric species of CitS would be expected: (CitS-AF546)2, (CitS-sC398-AF546)(CitS-sC398-AF568), and (CitS-sC398-AF568)2. At low surface density of fluorescent spots two-step bleaching and the colocalization of two fluorophores (AF546 and/or AF568) at one spot would prove the existence of the dimeric form. In the case of dual-color labeled CitS-sC3982 a simultaneous change of the dichroic ratio is expected upon stepwise bleaching of the two fluorophores that could serve as additional proof (Schutz et al. 1998
).
For each experiment we selected a specific single-molecule spot, collected the fluorescence photons, and computed the intensity and the dichroic ratio as a function of time. By simultaneously monitoring the polarization we could exclude the possibility that the decrease of emission intensity was caused by a reorientation of the fluorophores. Fig. 9 shows a typical time trace of dual-color labeled CitS-sC3982, i.e., (CitS-sC398-AF546)(CitS-sC398-AF568), including consecutive two-step bleaching of AF568 and AF546 (1700
800
100 counts per 0.1 s) and the associated change of the dichroic ratio (D) upon bleaching of the first fluorophore AF568. In summary, 48 spots were selected for evaluation. We observed two-step bleaching for 33 spots of which 17 showed an associated change of the dichroic ratio. Assuming a labeling efficiency of 80%, these numbers indicate a strong evidence of dimer formation of CitS. Intensively fluorescing spots, which exhibited a continuous instead of stepwise bleaching, were also observed. We assigned these spots to nonfunctional aggregates of a large number of molecules and discarded them from further analysis.
|
| DISCUSSION |
|---|
|
|
|---|
Nontrivial quenching mainly arises from the formation of nonfluorescent products (static quenching), collision with other molecules (dynamic or collisional quenching), and excitation energy transfer (Lakowicz, 1999
). In the present study we observed static quenching because only the number of fluorescent molecules decreased, whereas the remaining fluorescent spots showed unchanged photophysical properties. Static quenching can result from the formation of nonfluorescent species, electron or proton transfer, and
-stacking with aromatic systems. Most likely interactions between the fluorophore and proximate aromatic amino acid residues of the protein contribute to the observed effect. Which interaction accounts most for the dramatic quenching of the bound fluorophore AF546 remains to be investigated.
We suppose, therefore, that binding of citrate to CitS elicits a conformational change of the protein concomitant with an alteration of the molecular environment of AF546, and thus with the observed fluorescence quenching. The fluorescent probe is bound to C398 (loop X-XI) within the highly conserved C-terminal region, which probably includes the substrate binding site (Bandell and Lolkema, 2000b
) as proposed for the three closely related 2-hydroxy-carboxylate transporters CitS (K. pneumoniae), CitP (L. mesenteroides), and MleP (L. lactis). Hence, the citrate-induced conformational change either involves the loop X-XI region itself or other parts of the molecule interacting with this region. Similar ligand-induced fluorescent changes that were traced back to structural changes associated with substrate binding have been extensively studied for two other secondary active transport proteins using ensemble measurements, the H+-coupled lactose permease (Venkatesan and Kaback, 1998
; Wang et al., 1997
; Weitzman et al., 1995
; Wu et al., 1995
) and the H+/Na+-coupled melibiose permease (Cordat et al., 2000
; Mus-Veteau and Leblanc, 1996
; Mus-Veteau et al., 1995
) from E. coli.
CitS has a high-affinity citrate binding site (Ks
13 µM) proposed to be responsible in vivo for citrate binding from the periplasm and a low-affinity site (Ks
14 mM) from where citrate is assumed to dissociate into the cytoplasm (Pos and Dimroth, 1996
). The concentration of citrate used for the quenching studies (250 µM) was
20 times higher than the binding constant for citrate of the high-affinity site to ensure saturating conditions, and 60 times lower than that of the low-affinity binding site. Hence, the observed conformational change is apparently due to the occupation of the high-affinity site with citrate. Sodium ions, which are obligatory required for citrate uptake, had no noticeable effect on the citrate-induced fluorescence quenching, which probably indicates that citrate binding is Na+-independent, but a Na+-dependent step occurs later in the transport cycle.
Interestingly, preliminary data derived from citrate binding studies by isothermal titration calorimetry (Kaestner et al., unpublished; Wiseman et al., 1989
) indicated that the overall enthalpy change at the high-affinity site upon citrate binding was slightly endothermic (
Hhigh = 6 kJ/mol), whereas the observed enthalpy at the low-affinity site was exothermic (
Hlow = -55 kJ/mol). Similar observations have been made for other proteins with ligand-coupled conformational changes like the cAMP receptor protein (Gorshkova et al., 1995
) or the inosine monophosphate dehydrogenase (Bruzzese and Connelly, 1997
). There, the exothermic enthalpy of binding (
Hbind) is overwhelmed by the large endothermic enthalpy of the conformational transition (
Hconf) that takes place upon binding of the ligand.
For an increasing number of prokaryotic transporters it has been demonstrated that they form dimers. Examples are the tetracycline cation/proton antiporter TetA from Escherichia coli (McMurry and Levy, 1995
), the H+-coupled multidrug transporter EmrE from E. coli (Tate et al., 2001
), the lactose transporter LacS from Streptococcus thermophilus (Friesen et al., 2000
), and the Na+/H+ antiporter NhaA from E. coli (Gerchman et al., 2001
). For NhaA even two-dimensional crystals showed tightly packed dimers with well-defined interdimer contacts (Williams et al., 1999
). Interestingly, for the phosphate carrier (PIC) from Saccharomyces cerevisiae it was proven that only the dimeric form is completely active, which enables functional cross talk between the two monomers (Schroers et al., 1998
). In contrast, the monomeric as well as the dimeric form of lactose permease from E. coli were shown to be functional (Sahin-Toth et al., 1994
). Thus, the dimeric arrangement is not necessarily a functional requirement but might be due to protein/lipid interactions and stability reasons in a membrane environment. Moreover, there are theoretical arguments that oligomeric structures are particularly well-suited to integral membrane proteins with transport function (Klingenberg, 1981
). Our single-molecule studies with dual-labeled CitS-sC3982 and dual-color detection provided strong evidence for a dimeric association of CitS. The frequent occurrence of two-step bleaching and the simultaneous change of the dichroic ratio upon bleaching of the first fluorophore suggest that functional, detergent-solubilized CitS forms a rather stable homodimer. Together with the biochemical and kinetic indications (Pos et al., 1994
; Pos and Dimroth, 1996
) these results clearly support our hypothesis that the active form of CitS within the membrane is a homodimer.
In summary, we could demonstrate that fluorescence quenching of single molecules is a powerful technique to follow conformational changes such as that elicited by the binding of citrate within the region of loop X-XI of CitS. Furthermore, with the dual-color labeling and detection technique strong evidence for a dimeric arrangement of CitS was obtained. This technique is generally very useful to determine binding events of single molecules in an unambiguous fashion.
| ACKNOWLEDGEMENTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
Submitted on October 4, 2001; accepted for publication September 16, 2002.
| REFERENCES |
|---|
|
|
|---|
Bandell, M., V. Ansanay, N. Rachidi, S. Dequin, and J. S. Lolkema. 1997. Membrane potential-generating malate (MleP) and citrate (CitP) transporters of lactic acid bacteria are homologous proteins. Substrate specificity of the 2-hydroxycarboxylate transporter family. J. Biol. Chem. 272:1814018146.
Bandell, M., and J. S. Lolkema. 2000a. Arg-425 of the citrate transporter CitP is responsible for high affinity binding of di- and tricarboxylates. J. Biol. Chem. 275:3913039136.
Bandell, M., and J. S. Lolkema. 2000b. The conserved C-terminus of the citrate (CitP) and malate (MleP) transporters of lactic acid bacteria is involved in substrate recognition. Biochemistry. 39:1305913067.[Medline]
Bott, M., M. Meyer, and P. Dimroth. 1995. Regulation of anaerobic citrate metabolism in Klebsiella pneumoniae. Mol. Microbiol. 18:533546.[Medline]
Bruzzese, F. J., and P. R. Connelly. 1997. Allosteric properties of inosine monophosphate dehydrogenase revealed through the thermodynamics of binding of inosine 5'-monophosphate and mycophenolic acid. Temperature dependent heat capacity of binding as a signature of ligand-coupled conformational equilibria. Biochemistry. 36:1042810438.[Medline]
Cordat, E., G. Leblanc, and I. Mus-Veteau. 2000. Evidence for a role of helix IV in connecting cation- and sugar-binding sites of Escherichia coli melibiose permease. Biochemistry. 39:44934499.[Medline]
Dimroth, P. 1997. Primary sodium ion translocating enzymes. Biochim. Biophys. Acta. 1318:1151.[Medline]
Dimroth, P., and A. Thomer. 1986. Citrate transport in Klebsiella pneumoniae. Biol. Chem. Hoppe Seyler. 367:813823.[Medline]
Friesen, R. H., J. Knol, and B. Poolman. 2000. Quaternary structure of the lactose transport protein of Streptococcus thermophilus in the detergent-solubilized and membrane-reconstituted state. J. Biol. Chem. 275:3352733535.
Gerchman, Y., A. Rimon, M. Venturi, and E. Padan. 2001. Oligomerization of NhaA, the Na+/H+ antiporter of Escherichia coli in the membrane and its functional and structural consequences. Biochemistry. 40:34033412.[Medline]
Gorshkova, I., J. L. Moore, K. H. McKenney, and F. P. Schwarz. 1995. Thermodynamics of cyclic nucleotide binding to the cAMP receptor protein and its T127L mutant. J. Biol. Chem. 270:2167921683.
Haugland, R. P. 2000. Handbook of Fluorescent Probes and Research Chemicals. M. T. Spence, editor. Molecular Probes, Inc., Eugene.
Holo, H., and I. F. Nes. 1989. Appl. Environ. Microbiol. 55:31193123.
Kaestner, C. N., P. Dimroth, and K. M. Pos. 2000. The Na+-dependent citrate carrier of Klebsiella pneumoniae: high-level expression and site-directed mutagenesis of asparagine-185 and glutamate-194. Arch. Microbiol. 174:6773.[Medline]
Klingenberg, M. 1981. Membrane protein oligomeric structure and transport function. Nature. 290:449454.[Medline]
Laemmli, U. K., and K. Faure. 1973. Maturation of the head of bacteriophage T4. J. Mol. Biol. 80:575599.[Medline]
Lakowicz, J. R. 1999. Principles of Fluorescence Spectroscopy. Plenum Press, New York.
Lolkema, J. S., H. Enequist, and M. E. van der Rest. 1994. Transport of citrate catalyzed by the sodium-dependent citrate carrier of Klebsiella pneumoniae is obligatorily coupled to the transport of two sodium ions. Eur. J. Biochem. 220:469475.[Medline]
Marty-Teysset, C., J. S. Lolkema, P. Schmitt, C. Divies, and W. N. Konings. 1995. Membrane potential-generating transport of citrate and malate catalyzed by CitP of Leuconostoc mesenteroides. J. Biol. Chem. 270:2537025376.
McMurry, L. M., and S. B. Levy. 1995. The NH2-terminal half of the Tn10-specified tetracycline efflux protein TetA contains a dimerization domain. J. Biol. Chem. 270:2275222757.
Miroux, B., and J. E. Walker. 1996. Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels. J. Mol. Biol. 260:289298.[Medline]
Mus-Veteau, I., and G. Leblanc. 1996. Melibiose permease of Escherichia coli: structural organization of cosubstrate binding sites as deduced from tryptophan fluorescence analyses. Biochemistry. 35:1205312060.[Medline]
Mus-Veteau, I., T. Pourcher, and G. Leblanc. 1995. Melibiose permease of Escherichia coli: substrate-induced conformational changes monitored by tryptophan fluorescence spectroscopy. Biochemistry. 34:67756783.[Medline]
Peleg, G., P. Ghanouni, B. K. Kobilka, and R. N. Zare. 2001. Single-molecule spectroscopy of the ß2 adrenergic receptor: observation of conformational substrates in a membrane protein. Proc. Natl. Acad. Sci. USA. 98:84698474.
Pos, K. M., M. Bott, and P. Dimroth. 1994. Purification of two active fusion proteins of the Na+-dependent citrate carrier of Klebsiella pneumoniae. FEBS Lett. 347:3741.[Medline]
Pos, K. M., and P. Dimroth. 1996. Functional properties of the purified Na+-dependent citrate carrier of Klebsiella pneumoniae: evidence for asymmetric orientation of the carrier protein in proteoliposomes. Biochemistry. 35:10181026.[Medline]
Pos, K. M., C. N. Kaestner, and P. Dimroth. 1998. Role of conserved residues in the Na+-dependent citrate carrier of Klebsiella pneumoniae. EBEC Short Reports. 10:A12.
Prummer, M., C. G. Hubner, B. Sick, B. Hecht, A. Renn, and U. P. Wild. 2000. Single-molecule identification by spectrally and time resolved fluorescence detection. Anal. Chem. 72:443447.[Medline]
Sahin-Toth, M., M. C. Lawrence, and H. R. Kaback. 1994. Properties of permease dimer, a fusion protein containing two lactose permease molecules from Escherichia coli. Proc. Natl. Acad. Sci. USA. 91:54215425.
Saier, M. H., Jr. 2000. A functional-phylogenetic classification system for transmembrane solute transporters. Microbiol. Mol. Biol. Rev. 64:354411.
Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74:54635467.
Schägger, H., and G. Jagow. 1991. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199:223231.[Medline]
Schroers, A., A. Burkovski, H. Wohlrab, and R. Krämer. 1998. The phosphate carrier from yeast mitochondria. Dimerization is a prerequisite for function. J. Biol. Chem. 273:1426914276.
Simmons, J. S. 1926. A culture medium for differentiating organisms of typhiod-colon aerogenes groups and isolation of certain fungi. J. Infect. Dis. 39:209241.
Studier, F. W., and B. A. Moffatt. 1986. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189:113130.[Medline]
Schutz, G. J., W. Trabesinger, and T. Schmidt. 1998. Direct observation of ligand colocalization on individual receptor molecules. Biophys. J. 74:22232226.
Tate, C. G., E. R. Kunji, M. Lebendiker, and S. Schuldiner. 2001. The projection structure of EmrE, a proton-linked multidrug transporter from Escherichia coli, at 7 Å resolution. EMBO J. 20:7781.[Medline]
van Geest, M., I. Nilsson, G. von Heijne, and J. S. Lolkema. 1999. Insertion of a bacterial secondary transport protein in the endoplasmic reticulum membrane. J. Biol. Chem. 274:28162823.
Venkatesan, P., and H. R. Kaback. 1998. The substrate-binding site in the lactose permease of Escherichia coli. Proc. Natl. Acad. Sci. USA. 95:98029807.
Wang, Q., K. Matsushita, B. de Foresta, M. le Maire, and H. R. Kaback. 1997. Ligand-induced movement of helix X in the lactose permease from Escherichia coli: a fluorescence quenching study. Biochemistry. 36:1412014127.[Medline]
Weiner, M. P., G. L. Costa, W. Schoettlin, J. Cline, E. Mathur, and J. C. Bauer. 1994. Site-directed mutagenesis of double-stranded DNA by the polymerase chain reaction. Gene. 151:119123.[Medline]
Weiss, S. 1999. Fluorescence spectroscopy of single biomolecules. Science. 283:16761683.
Weitzman, C., T. G. Consler, and H. R. Kaback. 1995. Fluorescence of native single-Trp mutants in the lactose permease from Escherichia coli: structural properties and evidence for a substrate-induced conformational change. Protein Sci. 4:23102318.[Abstract]
Williams, K. A., U. Geldmacher-Kaufer, E. Padan, S. Schuldiner, and W. Kählbrandt. 1999. Projection structure of NhaA, a secondary transporter from Escherichia coli, at 4.0 Å resolution. EMBO J. 18:35583563.[Medline]
Wiseman, T., S. Williston, J. F. Brandts, and L. N. Lin. 1989. Rapid measurement of binding constants and heats of binding using a new titration calorimeter. Anal. Biochem. 179:131137.[Medline]
Wu, J., S. Frillingos, and H. R. Kaback. 1995. Dynamics of lactose permease of Escherichia coli determined by site-directed chemical labeling and fluorescence spectroscopy. Biochemistry. 34:82578263.[Medline]
Zhuang, X., T. Ha, H. D. Kim, T. Centner, S. Labeit, and S. Chu. 2000. Fluorescence quenching: a tool for single-molecule protein-folding study. Proc. Natl. Acad. Sci. USA. 97:1424114244.
This article has been cited by other articles:
![]() |
I. Sobczak and J. S. Lolkema The 2-Hydroxycarboxylate Transporter Family: Physiology, Structure, and Mechanism Microbiol. Mol. Biol. Rev., December 1, 2005; 69(4): 665 - 695. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |