This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Takahashi, S. X. Articles by Colecraft, H. M. Search for Related Content PubMed PubMed Citation Articles by Takahashi, S. X. Articles by Colecraft, H. M.

Distinctive Modulatory Effects of Five Human Auxiliary ß₂ Subunit Splice Variants on L-Type Calcium Channel Gating

Shoji X. Takahashi ^*, Scott Mittman  and Henry M. Colecraft ^*

Calcium Signals Laboratory, ^* Department of Biomedical Engineering, Department of Anesthesiology, Johns Hopkins University School of Medicine, Baltimore, Maryland

Correspondence: Address reprint requests to Henry M. Colecraft, Calcium Signals Laboratory, Dept. of Biomedical Engineering, Johns Hopkins University School of Medicine, 720 Rutland Ave., 726 Traylor Bldg., Baltimore, MD 21205. Tel.: 410-955-0072; Fax: 410-614-8269; E-mail: hcolecra{at}bme.jhu.edu.

	ABSTRACT

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSIONS ACKNOWLEDGEMENTS REFERENCES

 
Sequence analysis of the human genome permitted cloning of five Ca²⁺-channel ß₂ splice variants (ß_2a–ß_2e) that differed only in their proximal amino-termini. The functional consequences of such ß₂-subunit diversity were explored in recombinant L-type channels reconstituted in HEK 293 cells. ß_2a and ß_2e targeted autonomously to the plasma membrane, whereas ß_2b–ß_2d localized to the cytosol when expressed in HEK 293 cells. The pattern of modulation of L-type channel voltage-dependent inactivation gating correlated with the subcellular localization of the component ß₂ variant—membrane-bound ß_2a and ß_2e subunits conferred slow(er) channel inactivation kinetics and displayed a smaller fraction of channels recovering from inactivation with fast kinetics, compared to ß_2b–ß_2d channels. The varying effects of ß₂ subunits on inactivation gating were accounted for by a quantitative model in which L-type channels reversibly distributed between fast and slow forms of voltage-dependent inactivation—membrane-bound ß₂ subunits substantially decreased the steady-state fraction of fast inactivating channels. Finally, the ß₂ variants also had distinctive effects on L-type channel steady-state activation gating, as revealed by differences in the waveforms of tail-activation (G-V) curves, and conferred differing degrees of prepulse facilitation to the channel. Our results predict important physiological consequences arising from subtle changes in Ca²⁺-channel ß₂-subunit structure due to alternative splicing and emphasize the utility of splice variants in probing structure-function mechanisms.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSIONS ACKNOWLEDGEMENTS REFERENCES

 
High-voltage-activated (HVA) Ca²⁺ channels transduce electrical signals into diverse and essential processes such as muscle contraction, synaptic transmission, and gene expression. HVA Ca²⁺ channels are hetero-multimers comprised minimally of pore-forming ₁, and auxiliary ß and ₂ subunits. The rich variety of physiological responses mediated by HVA Ca²⁺ channels is mirrored by an equally impressive molecular diversity of individual subunits—seven genes encoding ₁ subunits (_1A–_1F, _1S), four encoding ß subunits (ß₁–ß₄), and three encoding ₂ subunits (₂-1 to ₂-3), have been identified (for review, see Catterall, 2000).

Auxiliary ß subunits are potent determinants of Ca²⁺ channel behavior. Qualitatively, all four ß-subunit isoforms act similarly to markedly increase surface membrane expression of co-expressed ₁-subunits (Chien et al., 1995; Brice et al., 1997; Gao et al., 1999; Yamaguchi et al., 2000), dramatically enhance Ca²⁺ current amplitude over that obtained with ₁ alone (Singer et al., 1991; Jones et al., 1998), and produce hyperpolarizing shifts in the voltage-dependence of channel activation (Singer et al., 1991; Perez-Reyes et al., 1992; De Waard et al., 1994). Just as important, there are significant distinctions in the properties of the different ß-subunit isoforms with respect to their tissue distribution (Castellano et al., 1993a,b; Ludwig et al., 1997; Pichler et al., 1997), subcellular localization (Colecraft et al., 2002), and impact on channel inactivation kinetics (Olcese et al., 1994; De Waard and Campbell, 1995; Wei et al., 2000; Colecraft et al., 2002). Such functional diversity of Ca²⁺ channel ß subunits is a likely contributor to the broad repertoire of physiological responses supported by HVA Ca²⁺ channels.

Alternative splicing generates an even greater molecular diversity of ß subunits, potentially extending the physiological dimensions of HVA Ca²⁺ channel functions (Collin et al., 1993; Cahill et al., 2000; Helton and Horne, 2002). Presently, however, knowledge of the full complement of ß-subunit splice variants that are expressed, and the biophysical and physiological traits that they impart, remains relatively obscure. Two key reasons for this impasse can be identified. First, discovery of ß-subunit variants has been driven primarily by traditional cloning methods that usually identify only one or a few members of a splice variant population at a time (Hullin et al., 1992; Perez-Reyes et al., 1992; Castellano et al., 1993a,b; Helton and Horne, 2002). Second, even when splice variants of a given ß subunit are known, the biophysical properties conferred by the distinct ß-splice forms to a given channel are rarely rigorously compared.

Research relating to splice variation in the Ca²⁺ channel ß₂ subunit epitomizes these deficiencies. ß₂ is the dominant ß subunit expressed in heart (Perez-Reyes et al., 1992; Pichler et al., 1997; Haase et al., 2000) and retina (Ball et al., 2002), but is also an important component of HVA Ca²⁺ channels expressed in brain (Ludwig et al., 1997; Pichler et al., 1997), smooth muscle (Reimer et al., 2000), and pancreas (Iwashima et al., 2001). Five distinct ß₂ subunits, varying only in the proximal amino terminus, have been cloned from different species including rat (Perez-Reyes et al., 1992), rabbit (Hullin et al., 1992), human (Rosenfeld et al., 1993), and mouse (Massa et al., 1995). To date, however, no more than three of the ß₂ forms have been identified in any one species (Qin et al., 1998), rendering it ambiguous whether they represent bona fide splice variants of the ß₂ gene. Also, aside from the first ß₂ subunit cloned, ß_2a, the biophysical properties of the different ß₂ variants have not been rigorously explored. This constitutes a critical impediment to understanding the physiological implications of having distinct ß₂ variants expressed in different tissues.

The recently published draft of the human genome sequence provides new opportunities to identify and clone novel splice variants of a given gene. Here, guided by genomic sequence analysis, we cloned all five ß₂ splice variants from human heart and brain cDNA libraries. The biophysical properties of the different ß₂ variants were explicitly compared in recombinant L-type (Ca_V 1.2; Ertel et al., 2000) Ca²⁺ channels (_1C, ß₂, ₂) reconstituted in HEK 293 cells. We found fundamental qualitative and quantitative distinctions among the subtly divergent ß₂-splice variants with respect to their subcellular localization and influence on L-type channel gating, providing new insights into structure-function mechanisms underlying _1C–ß₂-subunit interactions.

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSIONS ACKNOWLEDGEMENTS REFERENCES

 
Molecular cloning
To identify novel human Ca²⁺ channel ß₂ splice variants, we searched the HTGS database using TBLASTN algorithm with peptide query sequences derived from human (ß_2a and ß_2d) or other vertebrate species (ß_2b, ß_2c, and ß_2e). In some cases, either because of short peptide length or sequence differences, the TBLASTN search was not sensitive enough to find orthologous human sequences. In those cases, more sensitive similarity searches were performed on the draft BAC sequences identified in the first round of searches to locate the remaining sequences. The complete open reading frames of the five Ca²⁺ channel ß₂ splice variants were amplified from human brain (ß_2a, ß_2c, ß_2d, and ß_2e) and heart (ß_2b) cDNA libraries (Clontech) by PCR. Upstream primers for the PCR reactions were designed using sequence information from public databases. ß_2a, ß_2b, and ß_2e were amplified with the respective sense primers TCTGCCCCGCTAGCATGCAGTGCTGCGGGCTGGT, GGAATTGGGCTAGCATGCTTGACAGACGCCTTAT, GCGCTGTCGCTAGCATGAAGGCCACCTGGAT, and the antisense primer ACAAAAGGGCAGAATTCATTGGGGGATGTAAACA. Reactions contained 1 µl cDNA, 400 nM each primer, 200 µM each dNTP, 1.8 mM Mg²⁺ and 1 unit ELONGASE enzyme mix with its recommended buffer system in a total volume of 25 µl. Amplification was with a touchdown protocol with tubes held at 94°C for 30 s, a variable annealing temperature for 30 s, and extension at 68°C for 120 s. The initial cycle annealing temperature was 64°C; in each of the subsequent five cycles the annealing temperature was 0.5°C lower. In all subsequent cycles, the annealing temperature was 61°C. ß_2a and ß_2b PCR products were TA cloned into pCR2.1, and then cloned by NheI and EcoRI sites into the bicistronic expression vector pAd IR (Alseikhan et al., 2002), which contains a CMV promoter followed sequentially by a multiple cloning site, an internal ribosomal entry site sequence, and GFP cDNA. In this configuration, upon transfection into mammalian cells, ß₂-subunits and GFP are translated as independent protein entities from the same mRNA transcript. This permits GFP fluorescence to be directly used to verify cell transfection.

For ß_2c and ß_2d, a first round of amplification was performed with the following sense primers AGGGGAGTGGACTGGACCTG and AAAGGGACATGTCCAAGTCGCCTCCCACAG, and antisense primer GTTTTGGGGATGCTGTTAGT. Touchdown during the first 20 cycles was followed by 12 cycles with annealing temperature of 54°C. These amplicons were then gel-purified and reamplified with the respective sense primers CACATGGGCTAGCATGAATCAGGGGAGTGGACTGGACCTG and CCGACTTTGCTAGCATGGTCCAAAGGGACATGTCCAAGT, and antisense primer ACAAAAGGGCAGAATTCATTGGGGGATGTAAACA. Due to the relatively high rate of misincorporation with PCR amplification, most clones contained errors. Therefore, once one error-free clone of the ß_2b-splice variant (in pAd IR) had been identified, it served as the backbone for substitution of error-free versions of the four other D1 sequences via NheI and HindIII restriction sites. For GFP fusion constructs of ß₂ subunits, their complete coding sequences up to the penultimate codon were PCR amplified with high fidelity Pfu polymerase using as template the ß₂ subunits in pAd IR described above. Sense primers (as above) were used in conjunction with the antisense primer AGGATCCTTGGGGGATGTAAACATCCCTG. The PCR products were sequenced and cloned into the expression vector pAdCMV EGFP-N3 (Colecraft et al., 2002) using NheI and BamHI sites, yielding pAd CMV ß_2a–e-GFP. The cloned ß₂ variant sequences have been deposited in GenBank with the following accession numbers: ß_2a AF423189, ß_2b AF285239, ß_2c AF423190, ß_2d AF423191, and ß_2e AF423192.

Transfection of HEK 293 cells
Low-passage number HEK 293 cells were maintained as previously described (Brody et al., 1997). The calcium-phosphate precipitation method was used to transfect 10 µg each of cDNA encoding wild-type rabbit _1C (Wei et al., 1991), rat ₂ (Tomlinson et al., 1993), and the appropriate ß₂ splice variant (subunits).

Confocal imaging
ß₂-GFP fusion constructs were transiently transfected into HEK 293 cells, and confocal images were acquired 48 h posttransfection using a Zeiss laser-scanning confocal microscope. Exemplar intensity images were low-pass filtered and analyzed offline using custom-written software in MATLAB 6.0, Release 12 (Mathworks, Natick, MA).

Electrophysiology
Whole-cell recordings were obtained at room temperature 2–3 days after transfection using an Axopatch 200A patch-clamp amplifier (Axon Instruments, Union City, CA). Cells were continuously perfused with external solution containing (in mM): 140 TEA-MeSO₃, 10 HEPES, and 5 BaCl₂ (pH 7.3, adjusted with TEA-OH). The internal solution contained (in mM): 135 Cs-MeSO₃; 5 CsCl₂; 0.5 EGTA; 1 MgCl₂; 4 MgATP; and 10 HEPES (pH 7.3, adjusted with CsOH). Solution osmolarities were adjusted to 290–300 mOsm with glucose. Series resistances were typically 1–2 M after >70% compensation.

Currents were sampled at 10 kHz and filtered at 2 kHz, except for tail-activation protocols, in which currents were sampled at 25 kHz and filtered at 10 kHz. Voltage protocols were delivered at 60-s intervals, and leak and capacitive transients were subtracted by P/8 protocol.

Data and statistical analysis
Data were analyzed using custom-written software in MATLAB and Microsoft Excel, and are displayed as mean values ± SE. Recovery from inactivation, steady-state inactivation, and steady-state activation were well-described by the following equations, with parameters (Table 1) determined using least-squares criteria.

Steady-state inactivation data were fitted by a Boltzmann function of the form: h(20 s) = I₂/I₁ = 1/(1 + exp((V - V_1/2)/k)), where I₂ is the test-pulse current, I₁ is the normalization current, V is the membrane potential of the conditioning pulse, V_1/2 is the potential for half-inactivation, and k is the slope factor.

Steady-state activation data were fitted by a dual-Boltzmann function of the form: G/G_max = F_low/(1 + exp(V_1/2,low - V)/k_low) + (1 - F_low)/(1 + exp(V_1/2,high - V)/k_high)), where G is the tail current, G_max is the tail current evoked by a depolarization to +110 mV, F_low is the fraction of the low-threshold component, V is the membrane potential of the test pulse, V_1/2,low and V_1/2,high, and k_low and k_high are the half-activation potentials and slope factors for the low- and high-threshold components, respectively.

Kinetic modeling
Stochastic simulations were performed in MATLAB using the built-in matrix exponential function (expm) to solve an 11-state Markov chain for transition probabilities (Colquhoun and Hawkes, 1981). Repeated matrix exponential calls were made with a step size of 400 µs, and ionic currents were calculated assuming a linear conductance for Ba²⁺ with a reversal potential of +132 mV. Voltage-dependent transitions were modeled with rate constants of the form: k_ij(V) = k_ij x exp(z_ij x V x F/RT), where k_ij is a rate constant (in ms^-1) at zero membrane potential associated with the i-to-j transition, z_ij is the valence of the gating charge (set to one elementary charge for simplicity), V is the membrane potential (in mV), and RT/F is the gas constant and absolute temperature divided by Faraday's constant (equal to +25 mV). The final transition between closed and open states within each mode was modeled as voltage-independent (Zagotta and Aldrich, 1990; Colecraft et al., 2002) and set to the approximately ms timescale of rapid openings and closings during L-type Ca²⁺ channel bursts (Colecraft et al., 2002). The maximum P_o was set to 0.6. Parameters were optimized by eye. Fig. 8 C, Scheme 2, and Table 2 provide kinetic structure and detailed rate constants used in the simulations.

View larger version (29K): [in this window] [in a new window]   FIGURE 8  Quantitative descriptions of L-type channel inactivation gating profiles as conferred by distinct ß2 splice variants. (A–C) Alternative kinetic schemes that could account for the existence of two kinetically distinct inactivation states, which are suggested experimentally by the biexponential kinetics of channel recovery from inactivation. In Fig. 8 A, Scheme 1, inactive states were separated into those connected to the activation pathway with either fast or slow entry/exit rates (If and Is, respectively). In Fig. 8 C, Scheme 2, inactivation proceeds from the open state by only one pathway. In this case, the biexponential kinetics of recovery from inactivation arise from the existence of two channel populations (or modes) displaying kinetically distinct fast and slow modes of inactivation. (D–F) Simulations of inactivation gating of ß2a and ß2b channels using Fig. 8 C, Scheme 2 showed marked agreement between the model (black curves) and experimental data (gray curves, and , ). Values of rate constants used in simulations are presented in Table 2. In simulations, the fraction of fast channels was given by the corresponding Ffast values, as determined from recovery from inactivation protocols (Table 2). Note that for simulations of ß2a and ß2b channels, rate constants were identical in the two cases. Hence, all the differences between the channel types were completely accounted for by the differing values of the fraction of fast inactivating channels, Ffast. (G) In the case of steady-state inactivation, simulations using the dual-population model as described above (dotted lines) diverged from the experimental data (, ). Remarkably, when it was assumed that all the channels were gating in the slow mode, model predictions of steady-state inactivation (black curves) superimposed the experimental data. This suggested that during the ultra-long 20-s conditioning pulses used in steady-state inactivation protocols, channels consolidate into the slow inactivating mode. Evidence of such consolidation has been experimentally observed.

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSIONS ACKNOWLEDGEMENTS REFERENCES

View larger version (17K): [in this window] [in a new window]   FIGURE 1  Genomic perspective clarifies basis of Ca2+ channel ß2-subunit molecular diversity. (A) Modular domain structure proposed for Ca2+-channel ß subunits based on primary sequence identity. Two conserved domains (D2 and D4, gray boxes) are interspersed by three variable domains (D1, D3, and D5). D1 is an important determinant of channel inactivation, and D4 contains the ß-interaction domain, important for interactions with pore-forming 1-subunits. Alternative splicing of ß2 is known to occur in at least two regions, D1 and D3 (black boxes). (B) Schematic structure of human CACNB2 based on analysis of human genomic DNA sequence. Exons are represented by vertical lines and introns by horizontal lines; introns are approximately to scale, whereas exons are not to scale. (C) Schematic of mutually exclusive splicing patterns of exons 1–6 that result in the generation of five alternative ß2-subunit D1 domains. The corresponding amino acid sequences are represented. Exons 1, 2, and 4–6 encode the amino-termini of the distinct ß2 splice variants; each has their own initiation codon and 5' untranslated region (white box). Exon 3 is common to ß2c and ß2d. Exon 7 (gray box, with underlined sequence) is a constitutive exon that encodes the beginning of the D2 domain common to all ß2 variants.

Despite the predicted existence of at least five human ß₂ D1 splice variants, only ß_2a and ß_2d have thus far been cloned from human tissue (Rosenfeld et al., 1993; Yamaguchi et al., 2000). Armed with sequence information from the human genome, we designed primers that permitted the successful amplification of the open reading frames of all five variants from human heart (ß_2b) and brain (ß_2a, ß_2c–ß_2e) cDNA libraries. Having thus established the presence of ß_2a–ß_2e transcripts in human tissues, we next sought to determine the functional consequences of such ß₂-subunit diversity.

Distinctive subcellular targeting of ß₂-splice variants
The bulk of published work on Ca²⁺ channel ß₂-subunits has centered on ß_2a, the earliest cloned splice variant. A key distinguishing trait of ß_2a is that, when expressed alone in heterologous systems, it targets to the plasma membrane—an observation at odds with predictions that it would localize to the cytosol (Chien et al., 1995). This anomalous behavior is due to palmitoylation of two cysteines residing in the D1 domain (Chien et al., 1996; see also Fig. 1 C) and is the underlying basis for several unique functional hallmarks of ß_2a. None of the other ß₂-splice variants (ß_2b–ß_2e) retain consensus sequences for palmitoylation (Milligan et al., 1995; Resh, 1999), raising expectations that they would differ from ß_2a with respect to membrane targeting and any attendant functional sequelae. Nevertheless, since it is difficult to predict with certainty the subcellular localization of a protein, and because this feature is a vital prognosticator of ß-subunit function (Qin et al., 1998), we first sought to compare the subcellular targeting of heterologously expressed ß₂ variants.

To directly visualize ß₂-subunit localization in living cells, we expressed GFP-fusion constructs of ß_2a–ß_2e in HEK 293 cells and viewed cellular GFP fluorescence by confocal microscopy (Fig. 2). Cells expressing GFP alone displayed bright green fluorescence throughout the cell, with equal intensity in the nuclear and cytoplasmic compartments (not shown). Reassuringly, ß_2a-GFP localized to the periphery of the cell, a clear indication that fusion of GFP to the carboxyl terminus did not disrupt the well-known membrane targeting of ß_2a. In accord with their lack of consensus sites for palmitoylation and relatively high molecular weights (>90 kDa), ß_2b–ß_2d were localized to the cytosol and excluded from the nucleus (molecular weight cutoff for passive diffusion into the nucleus is 40 kDa; Davis, 1995). By contrast, ß_2e-GFP displayed plasma membrane targeting, akin to that observed with ß_2a (Fig. 2). This novel observation was completely unexpected given the hydrophilic character of the ß_2e D1 domain and serves to underscore uncertainties associated with a priori prediction of ß-subunit subcellular location.

View larger version (21K): [in this window] [in a new window]   FIGURE 2  Recombinant human ß2 splice variants target differentially in HEK 293 cells. (A) Confocal, and (B) line-scan images of ß2-GFP fusion proteins. ß2a and ß2e splice variants were localized to the plasma membrane; membrane targeting of ß2a is caused by palmitoylation of two cysteines in D1. In contrast, ß2b–ß2d variants were distributed throughout the cytosol but excluded from the nucleus. F is the normalized fluorescence intensity through the midpoint of images in A.

Divergent modulatory effects of ß₂-splice variants on L-type channel inactivation gating
Tuning of Ca²⁺ channel inactivation kinetics is a well-recognized and important function of auxiliary ß subunits. Therefore, we investigated this dimension of ß₂-splice variant function in recombinant L-type Ca²⁺ channels (_1C, ß₂, ₂) reconstituted in HEK 293 cells. Reconstitution of robust whole-cell Ba²⁺ currents (Figs. 3–6) amply demonstrated the viability of the cloned ß₂ subunits. In the absence of co-expressed ß subunits, reconstituted L-type channel currents are exceedingly small and only infrequently observed. Distinctive effects of ß₂ splice variants on key L-type channel inactivation parameters were measured as described below.

View larger version (13K): [in this window] [in a new window]   FIGURE 3  ß2 splice variants confer distinctive inactivation kinetics to recombinant L-type channels. (A) Normalized and averaged Ba2+ currents evoked by 1-s depolarizations to 0 mV. All currents had biexponential inactivation kinetics; those reconstituted with ß2a and ß2e had markedly slow inactivation kinetics compared to ß2b–ß2d. (B) Voltage-dependence of fast inactivation. The fraction of current remaining 300 ms into the test pulse, r300, was computed as an index of inactivation. Higher r300 values reflect a slower rate of inactivation. Inactivation conferred by ß2a and ß2e was markedly less voltage-dependent compared to ß2b–ß2d. In both A and B, ß2a data are reproduced as gray lines in ß2b–ß2e panels to permit direct visual comparison.

View larger version (15K): [in this window] [in a new window]   FIGURE 6  Different ß2 splice variants impart distinctive steady-state activation behavior to L-type channels. (A) Exemplar current traces from ß2a and ß2b channels evoked by a traditional tail-activation protocol in which channels were steady-state activated by a variable-voltage family of 20-ms test pulses, and tail currents measured after repolarization to -50 mV. Traces shown were obtained with test-pulse voltages of -20, 0, +40, and +100 mV. (B) Normalized (G/Gmax) G-V curves for channels incorporating the different ß2 variants. Smooth black curves through the data were generated from dual-Boltzmann functions as described in Methods, with parameter values given in Table 1. To generate fits, V1/2 and k values were constrained to the values given in the legend to Table 1, and the amplitudes of the low- and high-threshold components determined by least-squares criteria. The reproduced fits from ß2a data (gray curves) displayed varying degrees of difference from the data for other ß2 variants, visually affirming that distinct ß2 variants gave rise to differing fractions of channels that operated in the low threshold of activation regime.

View larger version (15K): [in this window] [in a new window]   FIGURE 4  L-type channel recovery from inactivation occurs with distinct fast and slow components, but with differing amplitudes, across ß2 splice variants. (A) Exemplar current traces from ß2a and ß2b channels evoked by a traditional recovery from inactivation protocol in which a 1-s prepulse to 0 mV is followed by a 50-ms test pulse to 0 mV at variable interpulse durations. Here and throughout, ß2a and ß2b exemplars are shown as representative slow- and fast-inactivating channels, respectively. (B) Plots of the fractional recovery from inactivation, RF. Data points were calculated as RF = (Itest - Iend)/(Iprepulse - Iend). Peak prepulse currents decreased by 20% for all ß2 variants by the end of the recovery protocol. This rundown was systematically accounted for in the analysis by normalizing all currents to the peak prepulse current from the first sweep. Smooth black curves through the data are biexponential fits generated from the equation presented in Methods. Curves were constrained to have the same fast- and slow- time constants, while the amplitudes of fast and slow components were determined by least-squares criteria (parameter values are presented in Table 1). Biexponential fits to ß2a data are reproduced in the other panels (gray curves) to facilitate visual comparison of the kinetics of recovery from inactivation among the ß2 splice variants. ß2a and ß2e had a smaller fraction of channels recovering from inactivation with fast kinetics compared to ß2b–ß2d channels.

View larger version (16K): [in this window] [in a new window]   FIGURE 5  L-type channel steady-state inactivation properties are relatively insensitive to the identity of the component ß2-subunit splice variant. (A) Exemplar current traces from ß2a and ß2b channels evoked by a traditional steady-state inactivation protocol in which a 10-ms normalizing pulse to 0 mV is followed sequentially by a variable-voltage family of 20-s conditioning pulses and a 100-ms test pulse to 0 mV. Only the first 200 ms of the currents during the conditioning depolarizations is shown. Traces shown were obtained with conditioning pulse voltages of 0, -30, -50, and -80 mV. (B) Plots of steady-state inactivation, h(20 s), as a function of voltage of the conditioning pulse. The normalized data points were obtained from the peak values of the prepulse and test currents, repectively, as h(20 s) = Itest/Iprepulse. Smooth black curve through the ß2a data was generated from a single Boltzmann function as described in Methods, with parameter values given in Table 1. Reproduction of the ß2a Boltzmann fit onto the panels for other ß2 splice variants (gray curves) demonstrated marked agreement with these other data, indicating little difference among the distinct ß2 variants.

We examined the voltage-dependence of channel inactivation by utilizing a family of 1-s voltage steps from -20 to +30 mV. To compare ß₂-splice variant signatures on the voltage-dependence of inactivation in a straightforward manner, we used the fraction of current remaining 300 ms after depolarization (r₃₀₀) as an index of channel inactivation (Fig. 3 B). For ß_2a channels, r₃₀₀ values barely changed in the voltage range from -20 mV (r₃₀₀ = 0.70 ± 0.03) to +20 mV (r₃₀₀ = 0.64 ± 0.03). Continuing the trend of functional similarities between these two ß₂ variants, r₃₀₀ values for ß_2e channels were mostly superimposed on values obtained for ß_2a channels (Fig. 3 B) over this voltage range. In sharp contrast, r₃₀₀ values for ß_2b–ß_2d channels dropped appreciably with increasing voltage, indicating a stronger voltage-dependence of inactivation for these channels compared to those reconstituted with ß_2a and ß_2e. Moreover, r₃₀₀ values for ß_2b–ß_2d channels were significantly depressed compared to values obtained for ß_2a and ß_2e channels over a wide range of voltages, reflecting the greater rate of macroscopic current decay observed with cytoplasmically localized ß₂ subunits (Fig. 3 B).

Recovery from inactivation
Next, we investigated the effects of ß₂-splice variants on the kinetics of L-type-channel recovery from inactivation. After a 1-s conditioning pulse to 0 mV, test-pulse currents recovered with biexponential kinetics for all the ß₂ forms (Fig. 4). In fact, across ß₂ variants, the two components of recovery from inactivation were well described as the sum of two exponential functions with identical time constants (_fast = 91.6 ms, and _slow = 20 s), but differing amplitudes (Fig. 4). Here again, there was a clear demarcation in the functional properties of membrane-bound versus cytosolic ß₂ variants—ß_2a and ß_2e displayed a similarly lower fraction of channels recovering from inactivation with fast kinetics, compared to ß_2b–ß_2d channels. This is visually apparent from the virtual congruence of recovery curves between ß_2a and ß_2e channels, and their divergence from curves obtained with ß_2b–ß_2d channels (Fig. 4). Mean values of the fractional recovery from inactivation (RF) measured at interpulse durations of 100 ms and 4.1 s were significantly different between ß_2a/e and ß_2b–d channels (RF₁₀₀ values were: ß_2a, 0.35 ± 0.03, n = 8; ß_2b, 0.53 ± 0.02, n = 7; ß_2c, 0.46 ± 0.05, n = 6; ß_2d, 0.47 ± 0.03, n = 5; ß_2e, 0.37 ± 0.05, n = 7; P < 0.01, one-way ANOVA). Our results are in qualitative agreement with previous work showing that L-type channels recover from inactivation with biexponential kinetics (Zuhlke and Reuter, 1998; Jeziorski et al., 2000). Moreover, distinct ß-subunit isoforms were found to differentially modulate L-type channel recovery from inactivation (Jeziorski et al., 2000). We now show that more subtle sequence variations conferred by alternative splicing within a single ß-subunit isoform are sufficient to confer differential modulation of L-type channel recovery from inactivation. The biexponential nature of the kinetics of recovery from inactivation strongly indicates the presence of two kinetically distinct forms of inactivation (Kass and Sanguinetti, 1984; Hering et al., 2000). We defer consideration of the possible physical processes underlying these forms of inactivation, and the mechanism of their differential modulation by ß₂ splice variants, to the Discussion.

Steady-state inactivation
Finally, to complete our examination of modulation of L-type channel inactivation gating by ß₂-splice variants, we probed quasi-steady-state inactivation (hereafter referred to as steady-state inactivation) using a three-pulse protocol in which a 10-ms prepulse to 0 mV was followed in turn by a family of 20-s conditioning pulses (-80 to +20 mV), and a 100-ms test pulse to 0 mV (Fig. 5). By contrast with the trends established above regarding clear-cut functional distinctions between membrane-bound and cytosolic ß₂ variants, there were only minor distinctions in steady-state inactivation curves (Fig. 5; Table 1). All the curves were well described by single-Boltzmann functions with identical values for k, and nearly identical values for V_1/2 (Table 1). This finding is in agreement with previous studies indicating a relative resistance of L-type channel steady-state inactivation curves to manipulation by distinct Ca²⁺ channel ß subunits (Jones et al., 1998). This is opposite the situation in neuronal Ca²⁺ channels (N-, P/Q- and R-type), where ß-subunit identity is a major determinant of steady-state inactivation profiles (Jones et al., 1998; Stea et al., 1994).

Overall, our in-depth study of modulation of L-type channel inactivation gating by ß₂ splice variants has revealed fundamental functional differences between membrane-bound (ß_2a and ß_2e) and cytosolic (ß_2b–ß_2d) ß₂ subunits. Further, we find that the functional distinctions imposed by membrane-bound ß₂ subunits on L-type channels are more pervasive than previously realized.

Distinctive effects of ß₂-splice variants on L-type channel steady-state activation and prepulse facilitation
One prominent effect of Ca²⁺ channel ß subunits is that they shift the voltage-dependence of Ca²⁺ channel activation gating in the hyperpolarizing direction. By contrast with their markedly divergent influences on channel inactivation kinetics, ß subunits are traditionally viewed as having more homogeneous effects on steady-state activation profiles. Moreover, while the D1 domain of ß subunits is appreciated to be an important determinant of Ca²⁺-channel inactivation, it is presumed to play only a minor role in steady-state activation. Recently, however, alternative D1 splice variants of the ß₄ subunit were found to differentially modulate the voltage-dependence of activation of N- and P/Q- type channels, thereby challenging this simple interpretation (Helton and Horne, 2002). Therefore, we investigated possible distinctions in ß₂ splice variant modulation of L-type channel steady-state activation utilizing traditional tail-activation (G-V) protocols (Fig. 6).

To permit first-order comparison of G-V curve waveforms among the ß₂ variants, we generated dual-Boltzmann fits by constraining V_1/2 and k values for both high- and low-threshold components, and determined the amplitudes of the two components by least-squares criteria (values in Table 1 and its legend). The impressive fits obtained for each ß₂ variant authenticated this strategy (Fig. 6 B). Explicit overlay of the fits to data obtained from ß_2a channels (gray traces in Fig. 6 B) onto the graphs for other splice variants provided a qualitative indication of distinctions in L-type channel steady-state activation among the different ß₂ variants. Most notably, ß_2b and ß_2e channels displayed G-V curves with opposite shifts in the relative amplitude of low- versus high-threshold components compared to ß_2a channels (Fig. 6 B). Specifically, whereas ß_2b decreased the fraction of channels activating at a lower voltage threshold (F_low = 0.36 for ß_2b versus 0.70 for ß_2a), ß_2e increased this parameter (F_low = 0.99). By contrast, ß_2c and ß_2d channels displayed G-V curves that were relatively unchanged, or only subtly different from ß_2a (Fig. 6 B). These results revealed an unappreciated role of the D1 domain of Ca²⁺-channel ß₂ subunits as an important determinant of L-type channel steady-state activation gating in addition to their more recognized function in modulating inactivation. The distinctions in activation gating did not extend to the kinetics of channel activation, as single exponential fits to the activation phase of currents evoked by 0-mV test pulses produced time constants that were not significantly different among the ß₂ variants (not shown).

A potential explanation (suggested by reviewers) for the increasing activation observed at positive voltages, evident as the high-threshold component of G-V curves (Fig. 6 B), could be voltage-dependent facilitation of L-type channels. If so, then the distinct ß₂ variants might be expected to differentially modulate this physiologically important property of L-type Ca²⁺ channels. This proposal was directly tested using a protocol in which test-pulse currents at a family of voltages were recorded with or without a 50-ms prepulse to +100 mV (Fig. 7 A). An interpulse duration of 50 ms at -100 mV was chosen, being long enough to ensure complete deactivation of channels after the prepulse, but short enough that any facilitation that was evoked by the prepulse would not have completely decayed. Exemplar currents evoked from ß_2a and ß_2b channels both displayed prepulse facilitation, although to different extents (Fig. 7). The larger degree of L-type channel facilitation conferred by ß_2b resulted in a more dramatic prepulse-induced hyperpolarizing shift in the G-V curve for ß_2b compared to ß_2a (Fig. 7 B), fitting with the suggestion that differences in voltage-dependent facilitation may play a role in establishing the observed distinctions in waveforms of steady-state activation curves (Fig. 6). Explicit comparison of L-type channel facilitation across all five ß₂-splice variants revealed that, compared to ß_2a, only ß_2b supported a significantly higher degree of facilitation (23.9 ± 4.8%, n = 8 for ß_2b; 10.4 ± 2.5%, n = 9 for ß_2a; P < 0.05, two-tailed Student's unpaired t-test; see also Fig. 7 C). Although ß_2d supported a high mean value of facilitation (28.4 ± 9.7%, n = 8), primarily due to a single cell that exhibited an unusually large degree of facilitation (86%), this value fell short of significance when compared to ß_2a (P = 0.08, two-tailed Student's unpaired t-test).

View larger version (18K): [in this window] [in a new window]   FIGURE 7  ß2 splice variants differentially affect prepulse facilitation of recombinant L-type channels. (A) Alternating prepulse voltage protocol (above) and exemplar Ba2+ test-pulse currents (below) recorded from L-type channels reconstituted with ß2a (left) or ß2b (right). Currents were evoked by a 20-ms test-pulse to 0 mV in the absence of prepulse (black traces) or after a 50-ms prepulse to +100 mV (gray traces); the interpulse duration was 50 ms. Tail currents were analyzed at -50 mV repolarization potential. (B) Normalized and averaged G-V curves generated from alternating-prepulse protocol for L-type channels reconstituted with ß2a (left, , ) and ß2b (right, •, ). Tail-current amplitudes were normalized to the current evoked at +110 mV in the absence of prepulse and plotted as a function of test-pulse potential, which was varied from -40 to +120 mV in 10-mV increments. Solid symbols (, •) denote currents evoked in the absence of prepulse; open symbols (, ) denote currents evoked after a prepulse. (C) Comparison of facilitation measured at a test-pulse potential of 0 mV across all five ß2 splice variants. Facilitation was calculated as the tail-current amplitude after a prepulse, normalized to the tail-current amplitude in the absence of prepulse. The difference between ß2a and ß2b was statistically significant (asterisk denotes P < 0.05, Student's t-test).

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION CONCLUSIONS ACKNOWLEDGEMENTS REFERENCES

 
The important findings presented in this study are: 1), human genomic sequence analyses permitted, for the first time, the cloning of five distinct amino-terminal ß₂-subunit variants from the same species, unambiguously identifying them as genuine splice variants of the ß₂ gene, CACNB2. 2), A second ß₂-subunit variant, ß_2e, targeted unexpectedly to the plasma membrane when expressed in HEK 293 cells, in a manner akin to that previously described for ß_2a. 3), The subcellular localization of the ß₂-subunit forms was correlated with the kinetics of L-type current decay—membrane-anchored subunits (ß_2a and ß_2e) produced slowly inactivating currents, whereas cytoplasmic subunits (ß_2b–ß_2d) imparted relatively faster inactivation kinetics. 4), For all subunit combinations, L-type channels displayed a biexponential recovery from inactivation. However, membrane-anchored ß_2a and ß_2e channels exhibited a smaller fraction of channels recovering with fast kinetics compared to their cytosol-localized counterparts. 5), L-type channel steady-state activation curves displayed low- and high-threshold components with distinct ß₂ splice variants differentially determining the relative amplitudes of the two components. 6), The distinct ß₂ variants supported varying degrees of prepulse facilitation of L-type channels.

We discuss these results in relation to previous studies in terms of their biophysical and physiological implications.

Historical perspective on cloning and nomenclature of Ca²⁺ channel ß₂-subunit splice variants
The first Ca²⁺ channel ß₂ subunit was cloned from rat brain (Perez-Reyes et al., 1992) and has commonly been referred to as ß_2a. Shortly thereafter, two ß₂-subunit homologs were cloned from rabbit heart (Hullin et al., 1992). These differed from each other and from the rat brain ß_2a subunit only in the amino-terminal D1 domain, all other parts of the proteins being essentially identical. Nevertheless, the rabbit clones were dubbed rabbit ß_2a and rabbit ß_2b. A fourth ß₂ variant with a unique D1 domain was subsequently cloned from human fetal brain (Rosenfeld et al., 1993) and is commonly referred to as ß_2c. Finally, a fifth ß₂ subunit with a distinctive D1 domain was cloned from mouse brain and was originally denoted as mouse brain ß_2a (Massa et al., 1995), although this variant has more recently been referred to as ß_2d (Yamaguchi et al., 2000). Before the present study, no more than three of the ß₂ forms had been cloned from any one species, making it uncertain whether all five were genuine splice variants, or simply reflected species variation. Recently, based on human genome sequence analysis, we reported that all five described ß₂ D1 domains were represented within the human ß₂ gene (Colecraft et al., 2002). Here, by cloning all five ß₂ forms from human cDNA libraries, we explicitly confirm their collective expression in a single species, unequivocally establishing that they are true splice variants. This insight validates our proposal to rename the five distinct ß₂ D1 variants ß_2a–ß_2e (Colecraft et al., 2002), as we have adopted in this study.

The fragmentary nature of the history of discovery of the distinct ß₂ variants can be attributed to limitations in traditional cloning methods, which rarely provide an exhaustive representation of splice variants within a given gene. The availability of the human genome sequence, and other ongoing mammalian genome sequencing efforts, provides a more panoramic perspective from which to study molecular diversity generated by alternative splicing. Genomic sequence information is particularly advantageous in identifying splice variants with different first or last exons. By contrast to splice variations that occur in internal exons, such first- and last-exon splice variants cannot be isolated by the technique of transcript-scanning PCR (Mittman et al., 1999). Overall, our study powerfully demonstrates the advantages of genome-based cloning over more traditional methods in identifying and cloning alternative splice variants of a gene.

Importance of Ca²⁺ channel ß-subunit subcellular localization
Hydropathy analysis indicates a lack of membrane-spanning domains in Ca²⁺-channel ß subunits (Perez-Reyes et al., 1992; Castellano et al., 1993a), predicting that they would localize to the cytosol when expressed in cells. This prediction is met for the majority of Ca²⁺-channel ß subunits so far examined. However, ß_2a bucked this trend when it was discovered that it targeted to the plasma membrane when exclusively expressed in HEK 293 cells (Chien et al., 1995). Subsequently, this anomalous localization was attributed to palmitoylation of ß_2a, in perfect agreement with the identification of a consensus motif for such modification in the amino terminus of the protein (Milligan et al., 1995; Chien et al., 1996; Resh, 1999). Importantly, such membrane localization of ß_2a has been associated with a constellation of distinguishing functional effects including: slowing of Ca²⁺-channel inactivation kinetics (Qin et al., 1998; Restituito et al., 2000); depolarizing shifts in the voltage-dependence of steady-state inactivation in neuronal Ca²⁺ channels (Jones et al., 1998); abolition of voltage-dependent facilitation of L-type channels expressed in Xenopus oocytes (Qin et al., 1998); and modulation of G-protein inhibition of neuronal Ca²⁺ channels (Qin et al., 1997). Hence, the subcellular location of ß subunits is an important determinant of function.

Here, we have identified ß_2e as a second ß₂ splice variant that targets anomalously to the plasma membrane when expressed alone in HEK 293 cells. The mechanism underlying ß_2e targeting to the membrane is unclear, although the molecular determinants of this localization must reside in its unique D1 domain. Unlike ß_2a, visual inspection of the ß_2e D1 domain does not immediately reveal likely sites for posttranslational lipid modification (Milligan et al., 1995; Resh, 1999). Further work will be needed to delineate the mechanism of ß_2e targeting to the membrane. Interestingly, ß_2a and ß_2e were functionally similar, lending support to the hypothesis that physical association with the membrane underlies the characteristic effects of ß_2a on Ca²⁺ channels (Restituito et al., 2000). The Ca²⁺-channel ß_1b subunit has also been reported to be membrane-localized when expressed in COS-7 cells (Brice et al., 1997) due to an acidic motif in the carboxyl terminus of the protein (Bogdanov et al., 2000). However, this property is not reproduced in other cell types (Chien et al., 1998; Colecraft et al., 2002) and does not result in any distinguishing electrophysiological phenotypes (Bogdanov et al., 2000). Hence, ß_2a and ß_2e are, thus far, clearly unique in this regard.

Our results contribute to a growing awareness that the subcellular distribution of Ca²⁺-channel subunits represents an important dimension of their function (Brice and Dolphin, 1999; Colecraft et al., 2002). The approach of viewing such distribution by tagging subunits with GFP is useful for such studies and offers the distinct advantages of: 1), permitting viewing of subunit localization in living cells, and 2), avoiding artifacts due to inaccessibility of epitopes or nonspecificity of antibodies. Indeed, we recently used this approach to reveal unexpected targeting of ß₄ subunits to the nucleus and transverse elements when expressed in heart cells (Colecraft et al., 2002). Nevertheless, the results of such experiments need to be interpreted with caution because of potential confounding factors arising from fusion of the relatively large GFP molecule to the target protein. For example, fusion of GFP to the amino-terminus of ß_2a abolishes membrane targeting, presumably by interfering with the palmitoylation of the cysteine residues in this region (H. M. Colecraft, unpublished observations).

Quantitative mechanism of ß₂-subunit modulation of L-type channel inactivation gating
L-type Ca²⁺ channels undergo at least three types of inactivation—Ca²⁺-dependent inactivation, and fast and slow forms of voltage inactivation. Ca²⁺-dependent inactivation is mediated by binding of Ca²⁺ to calmodulin that is tethered to the channel complex (Peterson et al., 1999; Qin et al., 1999; Zuhlke et al., 1999; Erickson et al., 2001; Pitt et al., 2001) and displays a characteristic "U-shaped" response to voltage that is a direct reflection of its current dependence. Our use of Ba²⁺ as charge carrier eliminates Ca²⁺-dependent inactivation; therefore, we will consider this form of inactivation no further. Instead, under our experimental conditions, fast and slow forms of voltage-dependent inactivation are prevalent. Mechanistically, it has been speculated that fast inactivation of HVA Ca²⁺ channels may be analogous to fast N-type inactivation in K⁺ channels (Hoshi et al., 1990; Zagotta et al., 1990) and to the fast hinged-lid inactivation mechanism in Na⁺ channels (West et al., 1992), both of which involve physical occlusion of the pore by cytoplasmic domains of the channel (Hering et al., 2000; Stotz and Zamponi, 2001). A leading candidate for the tethered plug in HVA Ca²⁺ channels is the cytoplasmic loop between domains I and II (I–II loop; Cens et al., 1999b; Stotz et al., 2000; Stotz and Zamponi, 2001), although the possible existence of inactivation gates on other parts of the pore-forming ₁ subunit, or accessory ß subunits, has not been excluded. Similarly, slow inactivation of Ca²⁺ channels may be analogous to C-type inactivation of K⁺ channels (Shi and Soldatov, 2002), which involves a constriction of the channel pore (Choi et al., 1991; Kukuljan et al., 1995). Here, the biexponential kinetics of current decay and recovery from inactivation authenticated the prevalence of both fast and slow inactivation across all five ß₂-splice variants. Nevertheless, there were key distinctions in L-type channel gating that segregated into two categories, depending on whether the associated ß₂ subunit was membrane-anchored, or localized in the cytosol. Specifically, membrane-anchored ß₂ subunits (ß_2a and ß_2e) produced a slower rate of channel inactivation (Fig. 3 A), exhibited elevated r₃₀₀ values over the range of voltages (Fig. 3 B), and displayed a smaller fraction of channels with fast recovery from inactivation kinetics (Fig. 4). By contrast, steady-state inactivation was not very different among distinct ß₂ variants (Fig. 5).

To gain mechanistic insights into the variable effects of ß₂ variants on L-type channel inactivation gating, we turned to quantitative modeling (Fig. 8). Since inactivation characteristics conferred by the ß₂ variants segregated into two major divisions, we modeled ß_2a and ß_2b channels as representatives of the two functional phenotypes. As a starting point, the biexponential kinetics of recovery from inactivation suggested two kinetically distinct inactivation states. Therefore, we first considered alternative schemes that could give rise to such behavior. In this regard, a three-state model consisting of one open and two inactive states was recently invoked to explain the biexponential kinetics of inactivation and recovery in recombinant P/Q-type Ca²⁺ channels (Sokolov et al., 2000; Berjukow et al., 2001). In those studies, inactivation from the open state could occur by two separate pathways with either a fast or slow rate. By itself, this minimal three-state model cannot describe features such as the voltage-dependence of inactivation or steady-state inactivation. Therefore, we incorporated the three-state inactivation mechanism into a modified Hodgkin-Huxley kinetic model (Fig. 8 A, Scheme 1), similar in structure to those previously used for voltage-gated K⁺ (Zagotta and Aldrich, 1990), Na⁺ (Armstrong and Bezanilla, 1977), and Ca²⁺ channels (Boland and Bean, 1993; Colecraft et al., 2002). Here, the activation pathway consisted of three voltage-dependent transitions (C C) followed by a distinct voltage-independent step immediately preceding channel opening (C O). Transitions from the activation pathway to the inactive states were state-dependent but voltage-independent; allosteric inactivation and recovery factors, f and h, respectively, served to hasten inactivation from the open state and enhance recovery to closed states (Klemic et al., 1998; Serrano et al., 1999). Additionally, inactive states were separated into those connected to the activation pathway with either fast or slow entry/exit rates (I_f and I_s respectively). Although simulations using Fig. 8 A, Scheme 1 could qualitatively predict aspects of the inactivation properties conferred by ß₂ splice variants, quantitative agreement with experimental data was elusive (simulations not shown). Moreover, it proved difficult to obtain simultaneous good fits to inactivation and recovery kinetics.

Consequently, we considered a second scheme that could describe the biexponential behavior of L-type channel inactivation and recovery from inactivation kinetics. Such behavior could arise from the existence of two channel populations displaying kinetically distinct fast and slow modes of inactivation (Fig. 8 B). To implement this dual-population scenario, fast and slow channels were both simulated independently using a modified Hodgkin-Huxley model (Fig. 8 C, Scheme 2). In contrast to Scheme 1, Fig. 8 A, inactivation could occur from the open state by only one pathway. Biexponential recovery-from-inactivation kinetics emerged from the existence of fast and slow channel populations rather than two exit pathways from the open state. For simplicity, the fast and slow channels employed identical rate parameters except for the microscopic inactivation rate constants k_i and k_r (Table 2). To simulate ß₂-subunit-specific effects on inactivation gating by this scheme, we set the fraction of fast channels to be the corresponding F_fast values calculated from recovery from inactivation protocols (Table 1) and computed the total current as the weighted sum of fast and slow channels.

This strategy furnished a strong agreement between model simulations and experimental data for inactivation and recovery kinetics (Fig. 8, D and F), a clear improvement over fits generated with Scheme 1. Less impressive initially was the fit to steady-state inactivation data generated by the model (Fig. 8 G, dotted trace). Remarkably, however, the model produced steady-state inactivation curves congruent with experimental data when it was assumed that all the channels were in the slow-inactivating mode (Fig. 8 G, solid curve). This finding suggested that over the exceptionally long 20-s prepulse duration employed to generate steady-state inactivation curves, initially fast-inactivated channels are consolidated into a slow-inactivated mode. In fact, such consolidation with increasingly prolonged depolarizations has been experimentally observed (Sokolov et al., 2000). For voltage-dependence of inactivation, simulations showed qualitative agreement, although they predicted a steeper voltage-dependence of r₃₀₀ for ß_2a than was experimentally determined (Fig. 8 E). This discordance may indicate that ß_2a may act to slow the microscopic propensity for inactivation in fast channels. Such a scenario would be consistent with the conceptualization that membrane tetherin