This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Komarov, A. G. Articles by Colombini, M. Search for Related Content PubMed PubMed Citation Articles by Komarov, A. G. Articles by Colombini, M.

The Physiological Properties of a Novel Family of VDAC-Like Proteins from Drosophila melanogaster

Alexander G. Komarov ^* , Brett H. Graham , William J. Craigen  and Marco Colombini ^*

^* Department of Biology, University of Maryland, College Park, Maryland 20742; Departments of Molecular and Human Genetics and Pediatrics, Baylor College of Medicine, Houston, Texas 77030; and St. Petersburg Nuclear Physics Institute, Gatchina, Russia, 188350

Correspondence: Address reprint requests to Marco Colombini, E-mail: colombin{at}umd.edu.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

 
VDAC, a major protein of the mitochondrial outer membrane, forms voltage-dependent, anion-selective channels permeable to most metabolites. Although multiple isoforms of VDAC have been found in different organisms, only one isoform (porin/DVDAC) has been previously reported for Drosophila melanogaster. We have examined the physiological properties of three other Drosophila proteins (CG17137, CG17139, and CG17140) whose primary sequences have significant homology to DVDAC. A comparison of their hydropathy profiles (ß-pattern) with known VDAC sequences indicates the same fundamental folding pattern but with major insertions and deletions. The ability of these proteins to form channels was tested on planar membranes and liposomes. Channel activity was observed with varying degrees of similarity to VDAC. Two of these proteins (CG17137 and CG17140) produced channels with anionic selectivity in the open state. Sometimes channels exhibited closure and voltage gating, but for CG17140 this occurred at much higher voltages than is typical for VDAC. CG17139 was not able to form channels. DVDAC and CG17137 were able to rescue the temperature-sensitive conditional-lethal phenotype of VDAC-deficient yeast, whereas CG17139 and CG17140 demonstrated no complementation. Similar structure and channel formation indicate that VDAC-like proteins are part of the larger VDAC family but the modifications are indicative of specialized functions.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

 
VDAC, also known as mitochondrial porin, is a 30–32 kDa channel-forming protein found in the mitochondrial outer membrane of all eucaryotes (Colombini et al., 1996). It forms an aqueous pore with a diameter of 3 nm in the open state and 1.8 nm in the closed state. This closed state is still conductive to small ions but effectively impermeant to anionic metabolites (Rostovtseva and Colombini, 1996; Rostovtseva et al., 2002). In the open state VDAC is permeable to nonelectrolytes up to 5000 Da. A model of the secondary structure of VDAC, consisting of one -helix and 13 ß-strands, has been proposed based on a variety of experiments (Song et al., 1998a). These 14 elements form a barrel-like structure that spans the membrane. Other theoretical models have been proposed with a larger number of transmembrane strands (Mannella, 1996). Spectroscopic studies have shown that transmembrane strands are tilted at a 45° angle (Abrecht et al., 2000).

VDAC from disparate eukaryotic species, from different kingdoms, share a form of VDAC with a highly conserved fundamental structure and in vitro electrophysiological properties. The length of the protein ranges between 274 and 295 amino acids. When studied in planar membranes, the channels formed by VDAC demonstrate multiple conductance states with different ionic selectivity: a single open state with high conductance and anionic selectivity, and multiple closed states with low conductance and cationic selectivity. The motion of the voltage-sensitive domain is responsible for channel gating (Song et al., 1998b). In the open state the positively charged voltage sensor is located in the transmembrane region. An increase in voltage causes the movement of the sensor toward the membrane surface resulting in an electrostatic barrier to anionic metabolites and therefore closure of the channel. The numerical values of the functional parameters such as single channel conductance, selectivity, and voltage dependence are very similar for VDAC from different species (Colombini, 1989).

VDAC plays a role in several fundamental cellular processes. By forming the major pathway for metabolite flux across the mitochondrial outer membrane, VDAC is involved in the regulation of metabolite flow across mitochondria and therefore influences mitochondrial function (Vander Heiden et al., 2000, 2001). VDAC may have an important role in the initiation of apoptosis as indicated by its regulation of Ca²⁺-uptake (Rapizzi et al., 2002) and possible participation in the formation of the permeability transition pore complex (Halestrap et al., 2002). VDAC closure and subsequent interference with ADP/ATP exchange (Vander Heiden et al., 2001) seem to lead to the permeabilization of the outer membrane to proteins resulting in the execution phase of apoptosis. In addition, VDAC has been reported to be a component of the peripheral benzodiazepine receptor complex (McEnery et al., 1992) and may be involved in binding hexokinase and glycerol kinase to mitochondria (Adams et al., 1991). Such a wide variety of functions may require the presence of specialized proteins in the form of isoforms and VDAC-like proteins.

Multiple VDAC isoforms have been identified in numerous diverse species including yeast (Blachly-Dyson et al., 1997), human/mouse (Sampson et al., 1996), and wheat (Elkeles et al., 1995). The electrophysiological characteristics of the prototypic VDAC from different species are highly conserved, yet the biophysical properties of individual isoforms from the same species are often quite distinct (Xu et al., 1999). Although the specific functions of individual VDAC isoforms remain to be elucidated, studies with in vivo model systems have given some insights. For example, although VDAC has been implicated in the initiation of apoptosis, one isoform, mammalian VDAC2, interacts with pro-apoptotic BAK to inhibit apoptosis (Cheng et al., 2003). Moreover, when overexpressed, yeast VDAC2 (POR2) was shown to restore normal cell growth in the absence of yeast VDAC1 (POR1) but did not form channels in reconstituted systems (Blachly-Dyson et al., 1997). This implies that a VDAC isoform can be involved in cell survival yet does not necessarily require channel-forming activity. Mice deficient for VDAC isoforms exhibit distinct phenotypes. VDAC1 deficient mice demonstrate altered mitochondrial permeability in skeletal muscle (Anflous et al., 2001), whereas VDAC3 deficient mice are infertile with structural sperm axonemal defects, in addition to respiratory chain abnormalities in muscle (Sampson et al., 2001). Finally, VDAC1, VDAC3, and VDAC1/VDAC3 deficient mice exhibit isoform-specific defects in learning and synaptic plasticity (Weeber et al., 2002).

The recent annotation of the Drosophila melanogaster genome (The-FlyBase-Consortium, 2003) revealed three putative VDAC isoforms whose genes are tightly clustered in tandem with the original Drosophila VDAC (DVDAC or porin) (Oliva et al., 2002). In this article, we describe our studies to characterize the physiological properties of these putative VDAC isoforms.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

 
Yeast strains and media
M3 (MAT lys2 his4 trp1 ade2 leu2 ura3) is the parental wild-type (with respect to POR1) strain. M22-2 (por1) contains a deletion of POR1 by insertion of yeast LEU2 at the POR1 locus (Blachly-Dyson et al., 1990). The yeast media YPD/SMM (2% dextrose as the carbon source/supplemented with essential nutrients except uracil) and YPG/SMM (3% glycerol as the carbon source/supplemented with essential nutrients except uracil) were prepared as described (Kaiser et al., 1994).

Generation of yeast expression constructs
For Drosophila VDAC, oligonucleotide-directed mutagenesis was used to generate a NcoI site at the start codon, and a NsiI site in the 3' UTR. This allowed for the complete open reading frame of the DVDAC cDNA to precisely replace the yeast VDAC1 gene previously subcloned into a single-copy yeast shuttle vector as previously described (Sampson et al., 1997). For CG17137, CG17139, and CG17140, oligonucleotide-directed mutagenesis was used to generate a blunt restriction enzyme site (EheI for CG17137, MlyI for CG17139, and PmeI for CG17140) at the first codon downstream of the start codon such that, when ligated to the NcoI-digested and blunted single-copy yeast shuttle vector, the open reading frame of the yeast VDAC1 is precisely replaced by the corresponding Drosophila cDNA. As with DVDAC, either a NsiI (CG17137 and CG17139) or a Sse 8387I (CG17140) (Sse 8387I generates ends compatible with NsiI) site was generated in the 3' UTR to facilitate cloning. To generate the multiple-copy yeast expression constructs for each Drosophila VDAC-like gene, the expression cassette (including the yeast VDAC1 promoter, 5' and 3' UTRs) was excised from the corresponding single-copy shuttle construct as a BamH1/HindIII fragment and cloned into the 2-µm yeast shuttle vector YEplac195 (Gietz and Sugino, 1988). The sequences of the oligonucleotides are as follows: DVDAC 5' = GGCAACCATGGCTCCTCCATCATACAG; DVDAC 3' =CCGCGATGCATTCACGACTAGCGGAAAACC; CG17137 5' = GCGAAGGCGCCGCCAAACACCGACATA; CG17137 3' = CCGCGATGCATCGTTAAGTGATTGGCAGT; CG17139 5' = GCGAAGAGTCCCATGAGAGAACGGATA; CG17139 3' = GCGACCTGCAGGCTACATATTGAAGTACCAT; CG17140 5' = GCGAGTTTAAACAACGGCTGCGCAACTT (note that this oligonucleotide also generates a silent GA mutation in the third position of the first codon downstream of the start codon); CG17140 3' = GCGAATGCATCAACAGTGAAAACCCCAGGAA. The cDNA templates utilized are as follows: porin = BDGP (Berkley Drosophila Genome Project) Clone ID GM13853 (GenBank AI518978); CG17137 = BDGP Clone ID AT15574 (GenBank BF500588), CG17139 = BDGP Clone ID AT07302 (GenBank BF505131), and CG17140 = AT08366 (GenBank BF506017) (Rubin et al., 2000).

Yeast complementation analysis
Each expression construct was introduced into the por1 Saccharomyces cerevisiae strain M22-2 by lithium acetate transformation (Gietz et al., 1992). As controls, wild-type (M3) and por1 yeast were transformed by the original single- or multiple-copy shuttle vectors. The yeast strains were then grown in 5 ml YPD/SMM liquid cultures at 30°C for 72 h. Each culture was normalized to the M3 cultures based on OD_{600 nm} and spotted onto 2 YPG/SMM plates as six-serial fivefold dilutions. The plates were incubated at 30°C or 37°C respectively for 6 days.

Preparation of yeast cells
To facilitate cell growth and harvesting, stock cultures were prepared. A colony of yeast cells, containing one of the VDAC-like genes, was inoculated into 50 ml medium consisting of 95 mg yeast nitrogen base (No. 0335-15-9, DIFCO LABORATORIES, Detroit, MI), 250 mg ammonium sulfate, 1 g dextrose, and 38.5 mg CSM-URA (No. 4511-222, Complete Supplement Mixture minus Uracil; Q-BIOgene, Carlsbad, CA). When the cells reached an OD of between 0.6 and 0.8 (at 600 nm) they were stored at 4°C for later use. For mitochondrial isolation, 9 ml yeast stock solution was inoculated into each of two flasks containing 1 L of the same medium and grown with shaking at 30°C. An OD between 0.7 and 0.8 was reached at 41 h after inoculation. Typically, 5–8 g of cells was obtained. A total of 5 g of cells was used for the isolation of mitochondria.

Isolation of VDAC-like proteins
Mitochondria were isolated from S. cerevisiae essentially as published by Daum et al. (1982) but modified as previously described (Lee et al., 1998). The final mitochondrial suspension was hypotonically shocked in 1 mM KCl, 1 mM HEPES, pH 7.5 to break the mitochondrial membranes and release soluble proteins. The membranes were sedimented at 24,000 g for 20 min.

VDAC-like proteins were isolated from mitochondrial membranes and purified according to standard methods (Mannella, 1982; Freitag et al., 1983). The last step was a 1:1 hydroxyapatite/celite column that, at low ionic strength, binds most proteins but allows VDAC to flow through. This also is a property of VDAC-like proteins.

Channel conductance measurements
Planar membranes were formed from monolayers made from a solution containing 0.5% diphytanoylphosphatidylcholine, 0.5% asolectin-soybean phospholipid (both were from Avanti Polar Lipids, Alabaster, AL), and 0.1% cholesterol (Sigma, St. Louis, MO) in hexane. The two monolayers formed a bilayer membrane across a 70–90-µm diameter aperture in a 15-µm thick Teflon partition that separated two chambers (modified Montal and Mueller technique; Montal and Mueller, 1972). The total capacitance was 70–80 pF and the film capacitance was 30–35 pF. Aqueous solutions of 1.0 M or 0.10 M NaCl and 1 mM MgCl₂ (in some experiments additional 1 mM CaCl₂ was present) were buffered by 5 mM HEPES at pH 7.0. All measurements were made at room temperature.

Channel insertion(s) was achieved by adding 0.2–2.0 µl 1% Triton X100 solution of purified VDAC-like protein to the 2.5 ml aqueous phase in the cis compartment while stirring.

The membrane potential was maintained using Ag/AgCl electrodes with 3.0 M KCl, 15% agarose bridges assembled within standard 200-µl pipette tips (Bezrukov and Vodyanoy, 1993). Potential is defined as positive when it is greater at the side of protein addition (cis). The current was amplified by an Axopatch 200B amplifier (Axon Instruments, Foster City, CA) in the voltage clamp mode.

Reversal potential measurements
The reversal or zero-current potential was measured to assess the selectivity in single or multichannel membranes. A positive reversal potential on the high salt side slows down the flux of anions down their gradient and increases the flux of cations. If a positive potential brings the current to zero then the channel must pass anions more readily than cations (i.e., has anionic selectivity). A negative potential would indicate cation selectivity. We used a 10-fold gradient of NaCl, 1.0 M cis and 0.10 M trans, plus Mg²⁺ and HEPES as above. An aliquot of solution containing VDAC-like protein was added to the side with higher concentration. As the channels can exist in different conformations each with different selectivity, triangular voltage waves were applied and the reversal potential of each state obtained by extrapolating the current record to zero current (see Fig. 6).

View larger version (12K): [in this window] [in a new window]   FIGURE 6  Selectivity of the channel(s) formed by CG17137 (A) and CG17140 (B) in the presence of a salt gradient. In the case with CG17140 both compartments also contained 1 mM CaCl2. The indicated voltage refers to the cis side. The voltage was applied in the form of slow triangular waves (3 mHz, ±73 mV). The dotted lines are extrapolations used to determine the reversal potential of each selected conductance level. The numbers associated with the zero-current intercepts show the value of the reversal potential.

A total of 50 µl of this liposome suspension were added to 0.8 ml 20 mM KCl, 1 mM EDTA, pH 7.0, and the absorbance at 400 nm was monitored. Nonelectrolytes of different molecular weight were dissolved in the same solution and added to the liposomes when the liposomes had stabilized (no change in absorbance with time). One might expect that upon shrinkage the KCl concentration in the liposomes would increase resulting in extended shrinkage as the KCl redistributes with time. In fact, in these liposomes K⁺ and Cl^- flux is so fast that these redistribute almost as rapidly as water. Indeed, if hypertonic KCl is used to attempt to shrink the liposomes, there is almost no shrinkage.

SDS-page electrophoresis
To determine whether we have VDAC-like proteins in the final fraction of the purification procedure, we used standard SDS-page electrophoresis procedure (Laemmli, 1970). Equal aliquots of solutions containing VDAC or VDAC-like proteins were mixed with concentrated sample buffer. Samples were separated on a 12% acrylamide gel supplemented with 4 M urea and the bands stained with GelCode Blue stain (Pierce, Rockford, IL).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

 
In addition to VDAC, D. melanogaster expresses three proteins whose primary sequences resemble that of VDAC, the VDAC-like proteins. The question to be addressed is how similar are these proteins to VDAC in terms of structure and function.

DVDAC and CG17137 rescue the conditional lethal phenotype of yeast cells deficient for VDAC1
Our initial approach for analyzing the function of the VDAC-like genes in D. melanogaster was to individually express them in a yeast strain that is deficient for the endogenous VDAC1 gene (por1). The por1 strain is characterized by a temperature-dependent growth-restrictive phenotype when cultured on a nonfermentable carbon source such as glycerol: cells are able to grow at 30°C, but not 37°C (Blachly-Dyson et al., 1990). It has been previously demonstrated that mammalian VDACs expressed in the por1 background rescue this conditional phenotype, allowing growth on glycerol at 37°C (Blachly-Dyson et al., 1993; Sampson et al., 1997). Ryerse et al. previously reported that DVDAC failed to complement por1 yeast (Ryerse et al., 1997). However, we observed that DVDAC does indeed complement POR1 function in por1 yeast when expressed from the POR1 promoter on either a single-copy (CEN) or a multiple-copy (2 µm) yeast shuttle vector (Fig. 1). Additionally, we observed that CG17137 rescued the por1 conditionally growth-restrictive phenotype when expressed from the single-copy vector. CG17139 and CG17140 both failed to complement por1 yeast whether expressed from single-copy or multiple-copy vector (Fig. 1).

View larger version (91K): [in this window] [in a new window]   FIGURE 1  Complementation analysis of DVDAC and VDAC-like genes in yeast. Wild-type (POR1), por1, or por1 yeast transformed with the indicated expression constructs plated on 3% glycerol and grown at the indicated temperatures are shown. In each panel, each row represents six serial fivefold dilutions of each strain as indicated.

View larger version (85K): [in this window] [in a new window]   FIGURE 2  The amino acid sequence of the D. melanogaster VDAC was aligned with VDAC-like sequences CG17137, CG17139, and CG17140. Colored boxes show matches between VDAC and any of the other sequences: yellow for uncharged amino acids, red for negative charged amino acids, and blue for positive charged amino acids. For the case of N-terminus extensions of CG17139 (1–54 amino acids) and CG17140 (1–74 amino acids) colored boxes indicate matches between the two sequences as well as all charged amino acid residues.

(1)

where (i) is the hydropathy value of the ith amino acid. This yields large numbers for a fragment that has alternating polar-nonpolar pattern. The ß-pattern parameters were plotted against the number of the first amino acid in the group. Analysis of Drosophila peptide sequences reveals peaks for the location of putative transmembrane strands (Fig. 3). These peaks correlate rather well with each other. The overall correlation coefficients are shown in Table 1. These are all highly statistically significant (>99%), but clearly there is stronger similarity between DVDAC and CG17137, and between CG17139 and CG17140. These results indicate that all compared sequences might share a similar secondary structure and a similar number of putative transmembrane strands.

View larger version (40K): [in this window] [in a new window]   FIGURE 3  A comparison of the ß-patterns (see text) of D. melanogaster VDAC, CG17137, CG17139, and CG17140. The dotted lines show similarity in location of the peaks. The gaps were generated based on the results of the primary structure alignment.

CG17137 forms typical VDAC channels
We examined the ability of CG17137 to increase the conductance of planar phospholipid membranes formed under standard conditions (see Materials and Methods). The detergent-solubilized protein was added to the aqueous phase on one side of the membrane and, after some time, conductance increments were observed. Fig. 4 A shows the insertion of a 0.31-nS conductance. This conductance responded to the application of elevated voltages by closing transitions reminiscent of VDAC. However, this was not always the case. In fact, results obtained with this protein were rather variable. CG17137 forms discrete conducting events but we were not able to identify, with confidence, a conductance characteristic of a single channel. The data suggest conducting pathways in the range of 0.5–8 nS in the presence of 1.0 M NaCl and 0.13–0.46 nS at the presence of 0.10 M NaCl. Based on the known properties of VDAC, one might propose that this range corresponds to a variety of different conductance states of a channel. The voltage dependent gating illustrated in Fig. 4 B and upon application of a triangular voltage wave (Fig. 5) is reminiscent of classical VDAC behavior. However, attempts at further confirmation by looking at selectivity changes associated with gating revealed a complex pattern. We assessed the selectivity by making measurements in the presence of a salt concentration gradient and extrapolating linear segments to determine the zero-current potential. As expected, conductance changes were associated with changes in the selectivity of the channel(s) (Fig. 6 A). Negative voltages correspond to a conductance with cationic selectivity and positive voltages with anionic selectivity. A single VDAC channel demonstrates anionic selectivity in the open state and cationic selectivity in the lower conducting closed states. In the case of conductance formed by CG17137 we observed that sometimes the closure of the channel(s) did result in a change toward a preference for cations but at other times the opposite was true. This inconsistency might be explained by a mixture of channel gating and channel insertion or disappearance but variability in the observed conductances also made it difficult to distinguish between these possibilities.

View larger version (15K): [in this window] [in a new window]   FIGURE 4  Changes in ionic current through a planar membrane in the presence of CG17137. Both compartments contained 0.10 M NaCl. (A) Insertion of the channel. (B) Gating of the channel at high voltages.

View larger version (20K): [in this window] [in a new window]   FIGURE 5  Voltage dependence of the conductance of the channels formed by CG17137 and CG 17140. The voltage was applied in the form of triangular waves (3 mHz, ±73 mV for CG17137 and ±120 mV for CG17140). The membranes contained 2–4 channels.

CG17140 also forms channels
Fig. 7 A shows discrete increases in the conductance of planar membranes after addition of detergent-solubilized CG17140. The observed single channel conductance was 1.38 ± 0.12 nS (mean ± SD) in 1.0 M NaCl. The channels gate (Fig. 7 B) but only at very high applied voltages (110 mV and higher; Fig. 7 B). Closure of a normal VDAC channel is observed at 30 mV and higher. Fig. 5 shows voltage-dependent closure at both positive and negative voltages but closure is incomplete in the voltage range tested. In the presence of a 10-fold salt gradient, CG17140 demonstrated a conductance of 0.61 ± 0.02 nS and a reversal potential of + 22.6 ± 2.4 mV, corresponding to anionic selectivity. Closure of these channels resulted in a switch to cationic selectivity with varying values of the reversal potential (Fig. 6 B). This is in agreement with typical VDAC behavior.

View larger version (12K): [in this window] [in a new window]   FIGURE 7  Changes in ionic current through a planar membrane in the presence of CG17140. Both compartments contained 1.0 M NaCl. (A) Insertion of two channels. (B) Gating of the channels at high voltage.

We incorporated CG17137, CG17139, and CG17140 into liposomes and measured the permeability of the liposomes, using hyperosmotic solutions of nonelectrolytes of different sizes. Mixing of liposomes with these solutions induces liposome shrinkage due to the fact that water moves out of the liposomes faster than the solute can move in. In the case of a permeable solute, reswelling follows the shrinkage of the liposomes. The shrinkage-reswelling process was observed by measuring changes in light scattering at 400 nm over time. A decrease of the liposome size causes an increase in apparent absorbance and a decrease of absorbance indicates reswelling of the liposomes. The rate of reswelling reflects the permeability of the liposome membrane. If the solute is impermeable it will demonstrate a lack of reswelling. Using this method we can also estimate the molecular weight cutoff of the permeability pathway.

Fig. 8 shows the absorbance traces for liposomes containing the VDAC-like proteins. The initial absorbance is due to rapid shrinkage resulting from the hypertonic stress of the indicated nonelectrolyte. This was followed by various rates of absorbance reduction due to permeation of nonelectrolyte into the liposomes. In CG17137-containing liposomes (top panel), reswelling occurred with all except the highest molecular weight of nonelectrolyte (PEG 6800). This molecular weight cutoff is the same as that reported for VDAC (Colombini, 1980). For CG17140-containing liposomes, the molecular weight cutoff was somewhat lower. The results show no significant reswelling in the presence of -cyclodextrin (1300 Da). The liposomes containing CG 17139 did not show significant reswelling with PEG 1500 (the slight decline was not different from control). The CG17139-containing liposomes did show permeability to PEG 1000, but this was also observed when liposomes were formed using mitochondrial membranes isolated from yeast lacking VDAC1 (Fig. 8, panel E, in Xu et al., 1999). Thus there is no detectable permeability increase by the presence of CG17139.

View larger version (13K): [in this window] [in a new window]   FIGURE 8  The responses of liposomes containing one of the proteins CG17137, CG17139, and CG17140 to osmotic pressure changes caused by nonelectrolytes. The liposomes were made as described in Material and Methods. The absorbance at 400 nm was recorded. When the liposomes had stabilized (no significant change in absorbance, 1 h after dilution) 67 µl 50 mM PEG6800, 67 µl 100 mM PEG3400, 67 µl 100 mM PEG1500, 220 µl 20 mM -cyclodextrin, 67 µl 225 mM PEG1000, or 67 µl 278 mM melezitose was added and quickly mixed at the point shown by the vertical arrows. All tracings in each panel were performed on the same set of liposomes so these can be readily compared. The tilted arrow indicates the brief mixing of the sample during recording showing no significant sedimentation of the liposomes.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

The VDAC-like proteins from D. melanogaster were tested for the major VDAC property, the ability to form voltage-dependent channels with characteristic channel size and ion selectivity. CG17137 and CG17140 clearly demonstrate channel-forming activity in both planar phospholipid membranes and in liposomes, CG17139 does not. The voltage dependence and selectivity are also reminiscent of classical VDAC behavior.

Insight into the physiological properties of these proteins was obtained by determining their ability to rescue the conditional lethal phenotype of yeast deficient for VDAC1 (POR1). We demonstrated that DVDAC and CG17137 can rescue VDAC-deficient yeast, whereas CG17139 and CG17140 cannot. It is unclear why Ryerse et al. could not demonstrate complementation with DVDAC (Ryerse et al., 1997). This complementation pattern roughly correlates to the observed biophysical characteristics of these proteins, with DVDAC demonstrating classical VDAC properties as previously reported (De Pinto et al., 1989). We have demonstrated that CG17137 also exhibits properties similar to those of classical VDAC in planar membranes and liposomes in terms of voltage gating and liposomal permeability. On the other hand, channels formed by CG17140 demonstrate conductance that is 40% of DVDAC or other classical VDACs and a smaller aqueous pore as indicated by the impermeability to -cyclodextrin (MW 1300), whereas CG17139 fails to form channels in either planar membranes or liposomes. The reduced size of the aqueous pore formed by CG17140 may restrict the flow of some critical metabolite resulting in failure of cells to grow at 37°C. In any case, of the three VDAC-like proteins, only CG17137 has properties similar enough to VDAC to functionally substitute for VDAC and thus could be an isoform of Drosophila VDAC.

The high degree of similarity between the ß-pattern of D. melanogaster VDAC and CG17137 indicates that they might share similar folding patterns. To view our results in the context of predicted secondary structures, we generated the folding patterns (Fig. 9) for all studied proteins by analogy with Neurospora crassa VDAC (Song et al., 1998a). The choice of candidate transmembrane ß-strands was based on the following criteria: 1), A candidate strand should have a good alternating hydrophilic and hydrophobic pattern; 2), Chain-distorting prolines should not be located in the middle of the transmembrane strand but rather at the ends of the strands; 3), There should be no adjacent charged amino acids except at the ends; 4), The strand should have good sequence homology to the corresponding transmembrane ß-strand for N. crassa VDAC.

View larger version (46K): [in this window] [in a new window]   FIGURE 9  The folding patterns for CG17137 (A), CG17139 (B), and CG17140 (C). The long loop region for CG17137 and the membrane regions have been highlighted: green circles, prolines; blue boxes, positively charged amino acid residues; red boxes, negatively charged amino acid residues. IMS, intermembrane space.

The sequences of CG17139 and CG17140 differ from both CG17137 and D. melanogaster VDAC in having long, highly charged, N-terminus extensions (Fig. 9). The role of this feature is unclear. The mouse VDAC2 isoform has such an extension, albeit considerably shorter, but forms channels with canonical VDAC properties. Perhaps, the highly charged N-terminus extensions could serve as a binding site for agents stimulating unknown activities of VDAC-like proteins.

Protein CG17139 differs from the other VDAC-like proteins in its inability to form channels either in planar membranes or in liposomes. Lack of channel formation in planar membranes could be attributed to inability to insert from the aqueous phase. However, the liposomes were formed from a protein-lipid mixture, and thus the protein must have been present in the liposomal membrane. To test the possibility that insufficient protein was present SDS-PAGE of the purified VDAC fractions from the expression yeast strains was performed (Fig. 10). Clearly the yield of CG17139 purified from the same amount of yeast cells was even larger than that obtained for CG17137 or CG17140.

View larger version (34K): [in this window] [in a new window]   FIGURE 10  SDS-PAGE electrophoresis image of yeast VDAC and VDAC-like proteins. The proteins were purified from mitochondrial membranes and run on 12% acrylamide gel. The upper band shown for each sample ran at 36 kDa.

In conclusion, our results indicate that despite the low degree of primary sequence identity with Drosophila VDAC, VDAC-like proteins have retained aspects of VDAC structure and function. The differential ability to complement VDAC-deficient yeast, and varied in vitro biophysical properties suggest that the members of this gene family in Drosophila play distinct physiological roles that need to be elucidated with future in vivo studies.

	ACKNOWLEDGEMENTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

 
This work was supported in part by National Institutes of Health NRSA 1F32GM065041-01 (B.H.G.), Baylor Child Health Research Center Scholarship (B.H.G.), National Institutes of Health RO1 N5042319 (W.J.C.), and National Institutes of Health R01 NS42319 (M.C.).

Submitted on May 21, 2003; accepted for publication September 8, 2003.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION ACKNOWLEDGEMENTS REFERENCES

 
Abrecht, H., E. Goormaghtigh, J. M. Ruysschaert, and F. Homble. 2000. Structure and orientation of two voltage-dependent anion-selective channel isoforms. An attenuated total reflection fourier-transform infrared spectroscopy study. J. Biol. Chem. 275:40992–40999.[Abstract/Free Full Text]

Adams, V., L. Griffin, J. Towbin, B. Gelb, K. Worley, and E. R. McCabe. 1991. Porin interaction with hexokinase and glycerol kinase: metabolic microcompartmentation at the outer mitochondrial membrane. Biochem. Med. Metab. Biol. 45:271–291.[Medline]

Anflous, K., D. D. Armstrong, and W. J. Craigen. 2001. Altered mitochondrial sensitivity for ADP and maintenance of creatine-stimulated respiration in oxidative striated muscles from VDAC1-deficient mice. J. Biol. Chem. 276:1954–1960.[Abstract/Free Full Text]

Bezrukov, S. M., and I. Vodyanoy. 1993. Probing alamethicin channels with water-soluble polymers. Effect on conductance of channel states. Biophys. J. 64:16–25.[Abstract/Free Full Text]

Blachly-Dyson, E., A. Baldini, M. Litt, E. R. McCabe, and M. Forte. 1994. Human genes encoding the voltage-dependent anion channel (VDAC) of the outer mitochondrial membrane: mapping and identification of two new isoforms. Genomics. 20:62–67.[Medline]

Blachly-Dyson, E., and M. Forte. 2001. VDAC channels. IUBMB Life. 52:113–118.[Medline]

Blachly-Dyson, E., S. Z. Peng, M. Colombini, and M. Forte. 1989. Probing the structure of the mitochondrial channel, VDAC, by site-directed mutagenesis: a progress report. J. Bioenerg. Biomembr. 21:471–483.[Medline]

Blachly-Dyson, E., S. Peng, M. Colombini, and M. Forte. 1990. Selectivity changes in site-directed mutants of the VDAC ion channel: structural implications. Science. 247:1233–1236.[Abstract/Free Full Text]

Blachly-Dyson, E., J. Song, W. J. Wolfgang, M. Colombini, and M. Forte. 1997. Multicopy suppressors of phenotypes resulting from the absence of yeast VDAC encode a VDAC-like protein. Mol. Cell. Biol. 17:5727–5738.[Abstract]

Blachly-Dyson, E., E. B. Zambronicz, W. H. Yu, V. Adams, E. R. McCabe, J. Adelman, M. Colombini, and M. Forte. 1993. Cloning and functional expression in yeast of two human isoforms of the outer mitochondrial membrane channel, the voltage-dependent anion channel. J. Biol. Chem. 268:1835–1841.[Abstract/Free Full Text]

Cheng, E. H.-Y., T. Sheiko, J. K. Fisher, W. J. Craigen, and S. J. Korsmeyer. 2003. VDAC2 inhibits BAK activation and mitochondrial apoptosis. Science. 301:513–517.[Abstract/Free Full Text]

Colombini, M. 1980. Structure and mode of action of a voltage dependent anion-selective channel (VDAC) located in the outer mitochondrial membrane. Ann. N. Y. Acad. Sci. 341:552–563.[Abstract]

Colombini, M. 1989. Voltage gating in the mitochondrial channel, VDAC. J. Membr. Biol. 111:103–111.[Medline]

Colombini, M., E. Blachly-Dyson, and M. Forte. 1996. VDAC, a channel in the outer mitochondrial membrane. In Ion Channels, Vol. 4. T. Narahashi, editor. Plenum Press, New York. 169–202.

Daum, G., P. C. Bohni, and G. Schatz. 1982. Import of proteins into mitochondria. Cytochrome b2 and cytochrome c peroxidase are located in the intermembrane space of yeast mitochondria. J. Biol. Chem. 257:13028–13033.[Abstract/Free Full Text]

De Pinto, V., R. Benz, C. Caggese, and F. Palmieri. 1989. Characterization of the mitochondrial porin from Drosophila melanogaster. Biochim. Biophys. Acta. 987:1–7.[Medline]

Elkeles, A., K. M. Devos, D. Graur, M. Zizi, and A. Breiman. 1995. Multiple cDNAs of wheat voltage-dependent anion channels (VDAC): isolation, differential expression, mapping and evolution. Plant Mol. Biol. 29:109–124.[Medline]

Freitag, H., R. Benz, and W. Neupert. 1983. Isolation and properties of the porin of the outer mitochondrial membrane from Neurospora crassa. Methods Enzymol. 97:286–294.[Medline]

Gietz, D., A. St Jean, R. A. Woods, and R. H. Schiestl. 1992. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 20:1425.[Free Full Text]

Gietz, R. D., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene. 74:527–534.[Medline]

Halestrap, A. P., G. P. McStay, and S. J. Clarke. 2002. The permeability transition pore complex: another view. Biochimie. 84:153–166.[Medline]

Holden, M. J., and M. Colombini. 1988. The mitochondrial outer membrane channel, VDAC, is modulated by a soluble protein. FEBS Lett. 241:105–109.[Medline]

Kaiser, C., S. Michaelis, and A. Mitchell. 1994. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105–132.[Medline]

Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T₄. Nature (Lond.). 227:680–685.[Medline]

Lee, A. C., X. Xu, E. Blachly-Dyson, M. Forte, and M. Colombini. 1998. The role of yeast VDAC genes on the permeability of the mitochondrial outer membrane. J. Membr. Biol. 161:173–181.[Medline]

Mannella, C. A. 1982. Structure of the outer mitochondrial membrane: ordered arrays of porelike subunits in outer-membrane fractions from Neurospora crassa mitochondria. J. Cell Biol. 94:680–687.[Abstract/Free Full Text]

Mannella, C. A. 1996. Mitochondrial channels revisited. J. Bioenerg. Biomembr. 28:89–91.[Medline]

McEnery, M. W., A. M. Snowman, R. R. Trifiletti, and S. H. Snyder. 1992. Isolation of the mitochondrial benzodiazepine receptor: association with the voltage-dependent anion channel and the adenine nucleotide carrier. Proc. Natl. Acad. Sci. USA. 89:3170–3174.[Abstract/Free Full Text]

Montal, M., and P. Mueller. 1972. Formation of bimolecular membranes from lipid monolayers and a study of their electrical properties. Proc. Natl. Acad. Sci. USA. 69:3561–3566.[Abstract/Free Full Text]

Oliva, M., V. De Pinto, P. Barsanti, and C. Caggese. 2002. A genetic analysis of the porin gene encoding a voltage-dependent anion channel protein in Drosophila melanogaster. Mol. Genet. Genomics. 267:746–756.[Medline]

Rapizzi, E., P. Pinton, G. Szabadkai, M. R. Wieckowski, G. Vandecasteele, G. Baird, R. A. Tuft, K. E. Fogarty, and R. Rizzuto. 2002. Recombinant expression of the voltage-dependent anion channel enhances the transfer of Ca2+ microdomains to mitochondria. J. Cell Biol. 159:613–624.[Abstract/Free Full Text]

Rostovtseva, T. K., and M. Colombini. 1996. ATP flux is controlled by a voltage-gated channel from the mitochondrial outer membrane. J. Biol. Chem. 271:28006–28008.[Abstract/Free Full Text]

Rostovtseva, T. K., A. Komarov, S. M. Bezrukov, and M. Colombini. 2002. Dynamics of nucleotides in VDAC channels: structure-specific noise generation. Biophys. J. 82:193–205.[Abstract/Free Full Text]

Rubin, G. M., L. Hong, P. Brokstein, M. Evans-Holm, E. Frise, M. Stapleton, and D. A. Harvey. 2000. A Drosophila complementary DNA resource. Science. 287:2222–2224.[Abstract/Free Full Text]

Ryerse, J., E. Blachly-Dyson, M. Forte, and B. Nagel. 1997. Cloning and molecular characterization of a voltage-dependent anion-selective channel (VDAC) from Drosophila melanogaster. Biochim. Biophys. Acta. 1327:204–212.[Medline]

Sampson, M. J., W. K. Decker, A. L. Beaudet, W. Ruitenbeek, D. Armstrong, M. J. Hicks, and W. J. Craigen. 2001. Immotile sperm and infertility in mice lacking mitochondrial voltage-dependent anion channel type 3. J. Biol. Chem. 276:39206–39212.[Abstract/Free Full Text]

Sampson, M. J., R. S. Lovell, and W. J. Craigen. 1997. The murine voltage-dependent anion channel gene family. Conserved structure and function. J. Biol. Chem. 272:18966–18973.[Abstract/Free Full Text]

Sampson, M. J., R. S. Lovell, D. B. Davison, and W. J. Craigen. 1996. A novel mouse mitochondrial voltage-dependent anion channel gene localizes to chromosome 8. Genomics. 36:192–196.[Medline]

Song, J., C. Midson, E. Blachly-Dyson, M. Forte, and M. Colombini. 1998a. The topology of VDAC as probed by biotin modification. J. Biol. Chem. 273:24406–24413.[Abstract/Free Full Text]

Song, J., C. Midson, E. Blachly-Dyson, M. Forte, and M. Colombini. 1998b. The sensor regions of VDAC are translocated from within the membrane to the surface during the gating processes. Biophys. J. 74:2926–2944.[Abstract/Free Full Text]

The-FlyBase-Consortium. 2003. The FlyBase database of the Drosophila genome projects and community literature. Nucleic Acids Res. 31:172–175.[Abstract/Free Full Text]

Thomas, L., E. Blachly-Dyson, M. Colombini, and M. Forte. 1993. Mapping of residues forming the voltage sensor of the voltage-dependent anion-selective channel. Proc. Natl. Acad. Sci. USA. 90:5446–5449.[Abstract/Free Full Text]

Vander Heiden, M. G., N. S. Chandel, X. X. Li, P. T. Schumacker, M. Colombini, and C. B. Thompson. 2000. Outer mitochondrial membrane permeability can regulate coupled respiration and cell survival. Proc. Natl. Acad. Sci. USA. 97:4666–4671.[Abstract/Free Full Text]

Vander Heiden, M. G., X. X. Li, E. Gottleib, R. B. Hill, C. B. Thompson, and M. Colombini. 2001. Bcl-x_L promotes the open configuration of VDAC and metabolite passage through the mitochondrial outer membrane. J. Biol. Chem. 276:19414–19419.[Abstract/Free Full Text]

Weeber, E. J., M. Levy, M. J. Sampson, K. Anflous, D. L. Armstrong, S. E. Brown, J. D. Sweatt, and W. J. Craigen. 2002. The role of mitochondrial porins and the permeability transition pore in learning and synaptic plasticity. J. Biol. Chem. 277:18891–18897.[Abstract/Free Full Text]

Xu, X., W. Decker, M. J. Sampson, W. J. Craigen, and M. Colombini. 1999. Mouse VDAC isoforms expressed in yeast: channel properties and their roles in mitochondrial outer membrane permeability. J. Membr. Biol. 170:89–102.[Medline]

This article has been cited by other articles:

				S. Hiller, R. G. Garces, T. J. Malia, V. Y. Orekhov, M. Colombini, and G. Wagner Solution Structure of the Integral Human Membrane Protein VDAC-1 in Detergent Micelles Science, August 29, 2008; 321(5893): 1206 - 1210. [Abstract] [Full Text] [PDF]

				R. Aiello, A. Messina, B. Schiffler, R. Benz, G. Tasco, R. Casadio, and V. De Pinto Functional Characterization of a Second Porin Isoform in Drosophila melanogaster: DMPORIN2 FORMS VOLTAGE-INDEPENDENT CATION-SELECTIVE PORES J. Biol. Chem., June 11, 2004; 279(24): 25364 - 25373. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Komarov, A. G. Articles by Colombini, M. Search for Related Content PubMed PubMed Citation Articles by Komarov, A. G. Articles by Colombini, M.