This Article Abstract Full Text (PDF) Supplement All Versions of this Article: biophysj.105.079343v1 91/6/2326    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bhattacharya, D. Articles by Shivashankar, G. V. Search for Related Content PubMed PubMed Citation Articles by Bhattacharya, D. Articles by Shivashankar, G. V.

EGFP-Tagged Core and Linker Histones Diffuse via Distinct Mechanisms within Living Cells

Dipanjan Bhattacharya ^*, Aprotim Mazumder ^*, S. Annie Miriam ^* and G. V. Shivashankar ^* 

^* National Center for Biological Sciences, TIFR, Bangalore-560065, India; and Raman Research Institute, Bangalore, India

Correspondence: Address reprint requests to G. V. Shivashankar, E-mail: shiva{at}ncbs.res.in.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSIONS ACKNOWLEDGEMENTS REFERENCES

 
The effect of chromatin organization on EGFP-tagged histone protein dynamics within the cell nucleus has been probed using fluorescence correlation and recovery measurements on single living HeLa cells. Our studies reveal that free fraction of core-particle histones exist as multimers within the cell nucleus whereas the linker histones exist in monomeric forms. The multimeric state of core histones is found to be invariant across mammalian and polytene chromosomes and this is ATP dependent. In contrast, the dynamics of the linker histones exhibits two distinct diffusion timescales corresponding to its transient binding and unbinding to chromatin governed by the tail domain residues. Under conditions of chromatin condensation induced by apoptosis, the free multimeric fraction of core histones is found to become immobile, while the monomeric linker histone mobility is partially reduced. In addition, we observe differences in nuclear colocalization of linker and core particle histones. These results are validated through Brownian dynamics simulation of core and linker histone mobility. Our findings provide a framework to understand the coupling between the state of chromatin assembly and histone protein dynamics that is central to accessing regulatory sites on the genome.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSIONS ACKNOWLEDGEMENTS REFERENCES

 
Core and linker histone proteins form the major class of nuclear proteins that condense the genome into a highly organized chromatin assembly within living cells (1). DNA wraps around core histones that exist in an octameric structure, with two dimers of H2A-H2B and a tetramer of H3-H4, called the nucleosome (2). The linker histones then clamp the entry and exit sites of DNA around the core histone octamer (3). The array of nucleosomes is repeated, forming the chromatin structure. The DNA-histone interactions are remodeled during cellular processes such as genome duplication, gene expression, and DNA repair (4). For this histone proteins undergo a variety of epigenetic modifications on their unstructured tail residues leading to the tightening, loosening, or removal of nucleosomes by chromatin remodeling machines (5). The dynamic removal and reassembly of histones and their variants are considered essential in the maintenance of epigenetic memory (6). The functional roles of core and linker histones are found to be distinct arising due to their differential nature of DNA association. Although the core histones with their epigenetic modifications play a central role in regulating access to DNA (7), the linker histones are thought to participate in maintaining the dynamic higher order chromatin structure (8). Although some of the linker histone variants play a role in somatic development (9), the implicit roles of linker histones remain unclear (10). Because histones are found to be regulators of cellular processes, understanding their in vivo dynamics in the context of chromatin organization and nuclear architecture has therefore become important.

Recent progress in fluorescence-based live-cell monitoring techniques (11) and modifying histone proteins with GFP fusion proteins (12) have provided new means to study their mobility within the nucleus. These studies have revealed that the core and linker histones that package the genome are highly dynamic within living cells. Core histones are found to exchange with a _1/2 130 min (13) whereas the linker histones have a _1/2 minutes (14,15). Most core histones are found to be associated with the chromatin and are maintained in position through mitosis. Among the free fraction of core histones, the H2A-H2B dimer exchanges more rapidly than the H3-H4 tetramer (13), suggesting that the bound H3-H4 may provide stable epigenetic markers (16). It is also found that replication independent dynamic exchange of the core histones is deposited to transcriptionally active sites (17). The exchange of H2A and H2B is found to be mediated by processes that are ATP dependent (18). In contrast, the mobility of linker histones and their subtypes is dependent on their tail residues (19) and affected by the phosphorylation of these residues (20). Despite the existing information on histone mobility within the nucleus, the underlying mechanisms of their diffusion remain unclear.

In this article, we explore quantitatively the nature of core and linker histone protein diffusion and its coupling to local chromatin assembly within living cells. The hindrance to histone protein mobility offered by the heterogeneous chromatin assembly is first established. We then show that the core histones exist in multimeric states and that their mobility is invariant across organisms. In contrast the linker histone mobility shows two distinct timescales, one arising due to normal diffusion and the other due to its interactions with chromatin. Colocalization experiments of histones reveal spatial heterogeneity in their enrichment within living cells. Functional perturbations to chromatin, such as ATP depletion and cell death, suggest differential roles for core and linker histone dynamics. The results are then validated through detailed numerical simulation to deduce the underlying diffusive mechanisms of core and linker histone protein dynamics.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSIONS ACKNOWLEDGEMENTS REFERENCES

 
Plasmid construction and cell culture
The H2B-EGFP expressing pBOS plasmid was gifted to us by Kanda et al. (12). Human H4-EGFP plasmid was made in two steps. The gene was first amplified from HeLa genomic DNA using primers (X60483, H4-fwd, 5'GGGGTACCATGTCTGGCC GCGG 3' and H4-rev, 5' CGGGATCCCCACCGAAACCGTAGAG 3'), was digested and ligated into pBOS-H2B-EGFP using KpnI and BamHI restriction sites. Then the BamHI-EGFP-NotI fragment from the resulting plasmid was replaced with a BglII-EGFP-NotI fragment from pEGFP N1 (Clontech, Palo Alto, CA) plasmid, to generate a 23 amino acid residue linker between H4 and EGFP, driven by an elongation factor (EF) 1 promoter. Human H1.1 gene, driven by CMV promoter, was amplified from HeLa genomic DNA using primers (X57130; H1.1-fwd, 5' GGGGGATCCATGTCTGAAACAGTGCCTC 3' and H1.1-rev, 5' AAAACCGGTTTCTTGGGTGCCGCTTTC 3') and cloned into pEGFP N1 vector using BamHI and AgeI restriction sites. Human H1.2 and H1.4 genes were amplified from HeLa genomic DNA using primers (X57129; H1.2-fwd, 5' GGGGTACCATGTCC GAGACTGCTCCTG 3'; H1.2-rev, 5'CGGGATCCCGTTTCTTCTTGGGCG3' and M60748; H1.4-fwd, 5'GGGGTACCATGTCCGAGACTGCGCC3'; H1.4-rev, 5'CGGGATCCTTTTTCTTGGCTGCCGC 3') and cloned into pEGFP N1 vector using KpnI and BamHI restriction sites. Human H1.5 gene was also amplified from HeLa genomic DNA using primers (X83509; H1.5-fwd, 5'GGGGTACCATGTCGGAAACCGC3'; H1.5-rev, 5'CGGGATCCT TCTTTTTGGCAGCC3') and ligated into pEGFP N1 vector at BamHI site on the 3' end and a blunt end on the 5' end. The tailless H1.1 was constructed by screening for the core domains of the proteins using the Conserved Domain Search database (http://www.ncbi.nlm.nih.gov/structure/cdd/wrpsb.cgi) and then amplifying the core domains alone. The tailless H1.1 gene was amplified from pH1.1-EGFP N1 by using primers (tailless H1.1-fwd, 5'GGGGGATCCATGTCCGTGTCAGAGC3'; tailless H1.1-rev, 5'AAAACCGGTTTGGTTTCCACGGAGG 3') and cloned into pEGFP N1 using AgeI and BamHI restriction sites.

HeLa cells were cultured in Dubelco's minimum eagle medium (DMEM) (Gibco, Paisley, UK) supplemented with 10% fetal bovine serum (FBS) (Gibco) and penicillin-streptomycin (Gibco), in a 5% CO₂ incubator. HeLa wild-type cells were transfected with 200 ng of DNA using lipofectamine 2000 (Invitrogen, Carlsbad, CA). Stable cell lines expressing H2B-EGFP were generated using selection by blasticidin. ATP depletion was realized by incubating cells for 1 h with 6 mM 2-deoxy-D-glucose and 10 mM sodium azide in Medium1 buffer at 37°C.

To flow sort the chromatin samples, HeLa cells were collected in M1 buffer (Tris-HCl 50 mM, MgCl₂ 100 mM, NH₄Cl 100 mM, 4% PEG 3350, pH 7.5) lysed by mechanical shearing with a 23-gauge needle and sonication. Then the fluorescently labeled chromatin was sorted out using a Becton-Dickinson (Franklin Lakes, NJ) FACSvantage flow sorter. The sorted chromatin was allowed to settle on poly-d-lysine (Sigma, St. Louis, MO) coated coverslips, and the tetramethylrhodamine (TMR)-dextran was externally added to the sample for fluorescence correlation spectroscopy (FCS) experiments.

Salivary gland cells (with polytene chromosomes), derived from the Drosophila larvae (transgenic flies bearing histone C-terminal H2B fused to EGFP), were used. The salivary glands, from the third instar larvae, were dissected in Ringers medium (or medium containing 600 mM NaCl for control experiments) using standard protocols. In brief, under an inspection microscope, the middle portion of the larvae is held using one micro-needle. Another pair of fine-tipped forceps is used to pull out the mouth region of the larvae. The salivary glands are dissected from this open preparation. The glands are then transferred onto a clean microscope No. 1 coverslip in the Ringer's medium and sealed using another coverslip. Care is taken to ensure that the cells are intact during the sample preparation procedure and the samples are stable for microscopic observations.

Fluorescence microscopy and FRAP experiments
All imaging experiments were done in Medium1 buffer (150 mM NaCl, 5 mM KCl, 1 mM CaCl₂, 1 mM MgCl₂, 20 mM HEPES, pH 7.3), supplemented with 1% glucose, except in ATP depletion experiments. A Zeiss Confocor (model-LSM510-Meta/Confocor2) fluorescence microscope equipped with fluorescence correlation spectroscopy was used in our experiments. For imaging, fluorescence recovery after photobleaching (FRAP) and FCS experiments, we used a C-Apochromat 40x/ 1.2 N.A water corrected objective. Confocal images (512 x 512 pixels, 12 bit images, pinhole aperture size 1 airy units) were acquired. EGFP and its fusion proteins were excited with the 488-nm line of an argon-ion laser (Lasos, Jena, Germany) and the emission collected with a 500–530 nm bandpass filter. Dextrans conjugated to tetramethyl rhodamine (TMR-dextrans (Molecular Probes, Eugene, OR)) was excited with a 543-nm helium-neon laser line, and imaged with a long pass 560-nm emission filter, whereas a 560–615 nm bandpass filter was used in FCS studies.

Fluorescence correlation spectroscopy
In FCS experiments, the correlation of the time course of intensity fluctuations of the fluorescence signal I(t) was measured. From the intensity time series the autocorrelation function, was calculated, where is the correlation time. The data was collected for a period of 10-s intervals and averaged over 10 runs to get the autocorrelation function and the corresponding fits. All FCS data is an average of more than 20 sets. The pinhole size was kept at 70 µm for 488-nm laser line (confocal diameter of 300 nm) and 78 µm for 543-nm laser line (confocal diameter of 360 nm). In our experiments, appropriate laser power of 488-nm line (argon-ion laser, Lasos) was used to avoid artefacts arising due to photobleaching and to ensure high counts per particle.

The following functions were used to fit the experimentally obtained autocorrelation curves. For unhindered three-dimensional (3D) diffusion:

(1)

Here N is the number concentration of the fluorescent species in the confocal volume, _D is the diffusion timescale, such that diffusion constant D = ²/4_D, where is the XY spread of the confocal spot, and s is the structure parameter; A and C are the triplet fraction and triplet timescales, respectively. However, for molecules like TMR-dextrans, activated notch, or the histone core particles, diffusion inside the cell nucleus cannot be adequately described by this model. To understand these results, we used the modified autocorrelation function with an anomalous subdiffusion term ß, which is a useful parameter to describe the underlying heterogeneity of the matrix (26,28,29).

(2)

The data obtained for the linker histone dynamics was fitted to a sum of two diffusing species. For this, we used the maximum entropy method, MEMFCS (35), used in FCS experiments, to fit our data to independently verify our assumption of using sum of two diffusing species to describe the dynamics of linker histones.

(3)

where, N₁ is the inverse of the total number of bright molecules (EGFP tagged linker histones) in the confocal volume and N₂ corresponds to the fraction of the species having correlation timescale _D1.

Numerical simulation of Brownian diffusion
Labview software from National Instruments (Austin, TX) is used to simulate Brownian diffusion of particles. Here the particles undergo 3D random walk with equal probability in each direction. A particle crossing the confocal volume, located around (0,0,0) position with a Gaussian profile, contribute to the intensity (fluorescence) signal, depending upon its coordinate in the profile. We then calculate the total intensity in each time trace for N such particles. From the intensity signal, we calculate the autocorrelation function and averaged over a number of traces.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSIONS ACKNOWLEDGEMENTS REFERENCES

 
Heterogeneity in chromatin organization is reflected in translational diffusion of molecules within the cell nucleus
Heterogeneity in chromatin assembly is the prime determinant of diffusion inside the cell nucleus (21). To correlate the size and function of the molecules with the chromatin architecture we have monitored, using FCS, the diffusion of differently sized noninteracting particles (EGFP and TMR-dextrans) inside the cell nucleus. Fig. 1 shows fluorescence images of HeLa cells expressing EGFP and HeLa cells incorporated with TMR-dextrans. Typical FCS curves associated with differently sized molecules are shown in Fig. 1. A small (R_H 1.5 nm), noninteracting particle such as EGFP is insensitive to the architecture and a 3D unhindered diffusion (Eq. 1) is sufficient to explain its diffusion behavior with D = 26.4 ± 2.7 µm²/s. Notably, EGFP diffusion either in the nucleus or in the cytoplasm show similar viscosity, in line with previous findings (22). Next, 10 kDa TMR-dextran (R_H 3 nm) was incorporated into HeLa cells by a hypotonic shock to the cells (23). However, the diffusion data for a large noninteracting molecule like TMR-dextran, could not be adequately described by simple 3D unhindered diffusion. The data was fitted to Eq. 2 and the fit parameter ß (mean value of the anomalous diffusion factor) was fixed at 0.67, which reflects the average chromatin mesh size. Here the diffusion timescale was D = 19.8 ± 4.9 µm²/s.

View larger version (31K): [in this window] [in a new window]   FIGURE 1  Heterogeneity in chromatin organization and its reflection on the translation diffusion of molecules within the cell nucleus. The fluorescence images of (i) EGFP-transfected and (ii) TMR-D incorporated HeLa cell nucleus. (Scale bar, 5 µm) and their associated autocorrelation function curves for EGFP (), and TMR-D (•) in the HeLa cell nucleus. (Inset) Probability histogram of ß-factor for TMR-D inside the cell nucleus (), in the buffer (), and in the sorted chromosome ().

Core histone dynamics
Core histone mobility is sensitive to chromatin assembly and exists in a multimeric state
Histone proteins condense the DNA into a highly organized chromatin assembly. We explored the diffusion of the free fraction of core histone proteins (H2B) to assess their dynamic interaction with the chromatin assembly as well as other core histones. The mobility of core histone H2B tagged with EGFP (H2B-EGFP (12)) within the cell nucleus was measured using FCS and the associated correlation curves are shown in Fig. 2 a. The typical correlation timescale is _D = 830.5 ± 232 µs (the corresponding diffusion constant D = 7.3 ± 1.9 µm²/s) under normal physiological conditions. The standard deviation in the timescales reflects the heterogeneity in the chromatin assembly. Interestingly, the mean correlation timescale for H2B-EGFP is much higher than what is expected from its molecular size (41 kDa), suggesting that it exists in a multimeric state. To test this, we measured the correlation timescale of H2B-EGFP in the cytoplasm, in transiently transfected HeLa cells overexpressing H2B-EGFP. The correlation timescale of H2B-EGFP in the cytoplasm _D = 268 ± 65.2 µs (with ß = 0.67) and the corresponding diffusion constant D = 22.2 ± 5.4 µm²/s were indicative of a monomeric state. It is likely that after the core histones translocate to the nucleus they multimerize. Similar results were obtained for another core histone H4-EGFP (Supplementary Material).

View larger version (25K): [in this window] [in a new window]   FIGURE 2  Core histone (H2B-EGFP) dynamics suggests their multimeric state. (a) Autocorrelation curves of EGFP in the cell nucleus and H2B-EGFP in the cytoplasm and in the nucleus. (Inset) Mean diffusion constants for the above cases. (b) Fluorescence images of the Drosophila salivary gland cell nucleus (polytene chromosomes) and HeLa nucleus and the associated autocorrelation curves of H2B-EGFP proteins in HeLa nucleus (), salivary gland cell nucleus (), and salivary gland cell nucleus with 600 mM NaCl (•). (Inset) Probability histograms of the diffusion correlation timescales for H2B-EGFP in HeLa nucleus and salivary gland cell nucleus and comparison of the probability histograms with H2B-EGFP diffusion in salivary gland cells in 600 mM NaCl concentration.

Spatial heterogeneity of chromatin architecture determines core histone mobility
We use salt-induced disassembly of nucleosomes to alter the heterogeneity of chromatin architecture. Upon addition of 600 mM NaCl (25), the chromatin architecture is affected, which is reflected in the change of ß-value. Here the correlation curve fits perfectly with single species normal 3D unhindered diffusion with a single mean correlation time scale of 301 ± 104 µs with the corresponding D = 20.9 ± 6.9 µm²/s (Fig. 2 b). The lower correlation time of H2B-EGFP upon addition of 600 mM NaCl is possibly due to the dissociation of both free and bound multimeric H2B-EGFP into monomers. With the addition of salt, the change in ß-value from 0.67 to 1 and the decrease in the standard deviation of correlation timescale suggest that diffusion of core histone proteins is dependent on the spatial heterogeneity of chromatin architecture within the cell nucleus.

Linker histone dynamics
Linker histone diffusion is distinct from core histones and reveals two timescales
Linker histones bind at the entry and exit sites of DNA on the nucleosome to form a stable higher order chromatin structure and this interaction has been suggested to be highly dynamic (14,15). We find that the autocorrelation behavior of the linker histone protein H1.1-EGFP, measured using FCS, is significantly different from that of the core histone proteins Fig. 3 a. Here the FCS curves do not fit with single species 3D unhindered diffusion or with the anomalous diffusion. Clearly there is a second distinct timescale in the autocorrelation function, which may be attributed to the dynamic interactions of the linker histones with the chromatin fiber, consistent with earlier FRAP studies (14,15). To obtain the underlying diffusion timescales, we have fitted the data with a two species diffusion model described in the Methods section. The fits to the data show two distinct timescales (_D1 = 298.3 ± 58.8 µs) with diffusion constant D₁ = 19.5 ± 3.5 µm²/s commensurate with 3D diffusion, and (_D2 = 26.5 ± 12.8 ms) D₂ = 0.3 ± 0.1 µm²/s possibly arising due to H1.1-EGFP interaction with DNA.

View larger version (29K): [in this window] [in a new window]   FIGURE 3  Linker histone shows distinct interaction timescales inside the cell nucleus. (a) Fluorescence images of H1.1-EGFP and tailless H1.1-EGFP transfected HeLa nucleus (scale bar, 5 µm) and the associated autocorrelation function curves for H1.1-EGFP (), tailless H1.1-EGFP (). (Inset) Fluorescence recovery curves for tailless H1.1-EGFP, H1.1-EGFP, EGFP, and core histones, H2B-EGFP and H4-EGFP. (b) Different subtypes of H1 proteins show distinct interaction timescales. Autocorrelation curves for different H1 subtypes, H1.1, H1.2, H1.4, H1.5 inside the HeLa cell nucleus. (Inset) Normalized FRAP data for different subtypes of H1 proteins, H1.1, H1.2, H1.4, and H1.5. (c) Probability histograms of different subtypes of H1 proteins H1.1-EGFP, H1.2-EGFP, H1.4-EGFP, H1.5-EGFP. (Inset to panel c (i)) Mean and standard deviations of the fractions of the noninteracting species in different H1 subtypes. (Inset to panel c (ii)) Autocorrelation function curves for H1.5-EGFP, in the cytoplasm and inside the cell nucleus.

Linker histone subtypes show distinct changes in their mobility and localization
To see if the various linker histone subtypes show similar diffusion characteristics, we repeated our investigations on linker histone subtypes (H1.2, H1.4, and H1.5). These histones also showed two distinct timescales of diffusion where the mean second timescale (₂) corresponded to 28 ms, 34 ms, 34 ms for H1.2, H1.4, H1.5, respectively (Fig. 3, b and c). A fit of the interaction timescale (₂) with the normal distribution shows that the peak values of the distribution function is statistically distinct for H1.1, and H1.2 compared to H1.4 and H1.5 (Fig. 3 c). The C-terminal tails of H1.1 and H1.2 are smaller, with less number of interacting residues, than that of H1.4 and H1.5. This is possibly reflected in the shorter diffusion timescale commensurate with their tail lengths that define the extent of interactions. The data on the fraction of interacting linker histone subtypes is shown in the inset to Fig. 3 c.

To outline the differences in mobility between different linker histone subtypes, both FRAP and FCS experiments were performed within the cell nucleus. In FRAP experiments, the bleaching cross section was 3 µm and the mean recovery curve is an average of the FRAP from 10 different cells. The FRAP data shows that the fluorescence recovery of the linker histones are markedly faster than the core particles (H2B and H4). This is in line with previous observations in the literature (13–15) and is characteristic of the dynamic nature of interactions associated with linker histones. A comparison of the FRAP data between different subtypes of H1 proteins shows that the H1.1, H1.2, H1.4, H1.5 recover to about 96%, 87%, 83%, 83% in a time duration of 160 s. In contrast, core histones H2B and H4 recover to <20% over a 30-min timescale. The colocalization experiments between the various linker histone subtypes, show differences in their spatial localization within the cell nucleus, possibly a reflection of their functional roles (Supplementary Material).

Functional perturbations such as ATP depletion and cell death differentially affect core and linker histone dynamics
Alterations in core and linker histone diffusion during ATP depletion
To probe whether the multimeric state of the H2B is ATP dependent, we carried out FCS measurements on H2B-EGFP in ATP-depleted cells. Fig. 4 a shows the distribution of correlation timescale in H2B-EGFP cells under normal and ATP-depleted conditions. Upon ATP depletion, there is a significant decrease in both the mean correlation timescale _D = 533.5 ± 248.3 µs (D = 12.7 ± 5.3 µm²/s) and its distribution reflecting the emergence of a fast timescale. This could be possibly due to an enriched monomeric fraction upon ATP depletion, suggesting that the maintenance of the multimeric state is an energy-dependent process. Similar results are obtained for another core histone particle, H4-EGFP (Supplementary Material). To check if the linker histone diffusion is ATP dependent, FCS measurements were carried out on ATP-depleted HeLa cells. These showed that unlike core histones, the mobility of linker histones remains invariant upon ATP depletion (Fig. 4 a).

View larger version (43K): [in this window] [in a new window]   FIGURE 4  (a) Fluorescence images of H2B-EGFP transfected HeLa nucleus before and after ATP depletion. (Scale bar, 5 µm). (i) Probability histograms of correlation timescales of H2B-EGFP diffusion inside HeLa nucleus before and after ATP depletion. The bar graphs of the mean correlation timescales are also shown in the inset. (ii) Probability histograms of H1.5-EGFP correlation timescale in milliseconds, before and after ATP depletion. (b) Time course of histone protein dynamics within cells upon induction of apoptosis. (i) Autocorrelation function curves for H2B-EGFP before and after 4 h of addition of staurosporine in HeLa cells. (Inset) Fluorescence images of H2B-EGFP transfected HeLa cells before and after addition of staurosporine. (Scale bar, 5 µm). (ii) FRAP curves for H1.1-EGFP in HeLa cells, in normal conditions and after staurosporine treatment.

These findings using a combination of FCS and FRAP techniques on both linker and core histones, suggest that core histones, are more adversely affected by induction of apoptosis in comparison with those of linker histones or a free molecule that interact less with the chromatin. The measured diffusion constants from all the experiments are presented in Table 1.

X

View larger version (22K): [in this window] [in a new window]   FIGURE 5  Numerical simulation study of core and linker histone dynamics. (a) Autocorrelation function generated by numerical simulation for single species of 3D diffusion with confined mesh structure with varying sizes (m = 0, 10, 50). (Inset (i)) Typical single particle trajectory of 2D random walk generated within a confined mesh structure. (Inset (ii)) Mean square displacement versus time for different mesh sizes (m = 0, 11, 12, 15). (b) Autocorrelation function generated by numerical simulation for 3D diffusion with randomly distributed interacting sites (N = 0, 1500, 2000, and 3000). (Inset) Typical single particle trajectory of 2D random walk.

	DISCUSSIONS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSIONS ACKNOWLEDGEMENTS REFERENCES

 
Implications of core histone dynamics
Histone protein dynamics within the cell nucleus has become increasingly important in the context of chromatin remodeling, epigenetic states, and various genetic processes (27). Our results suggest that core histones are in a multimeric form whereas the linker histones are in monomeric form within the cell nucleus. The diffusion of multimeric core histones is sensitive to the architecture of the chromatin assembly. Previous measurements suggested that the reconstituted nucleosomes, with a hydrodynamic diameter of 10 nm that diffused through a polymer mesh, underwent anamolous diffusion (28). The chromatin architecture within the cell nucleus is reminiscent of a dynamic polymer matrix characterized by a mesh size. Molecules smaller than 3 nm hydrodynamic radius (EGFP, R_H 1.7 nm) undergo unhindered diffusion whereas larger molecules are confined by the mesh. The physical origins of anomalous diffusion arise due to such confinement, where additional time is spent during each random Brownian step. In such cases, the mean square displacement is not proportional to time but proportional to t^ß, where ß (ß < 1) is a measure of the confinement (29). This multimerization process is found to be ATP dependent because upon ATP depletion the multimeric core histones (H2B-EGFP) become monomeric, outlined in the schematic in Fig. 6. Interestingly, the depletion of ATP leads to the enrichment of monomeric, unbound core histones within the nucleus. This illustrates the existence of a dynamic equilibrium between the chromatin-bound and free fraction of core histones that is tuned by energy-dependent processes. A similar-sized molecule, such as a transcription cofactor activated notch, also undergoes confined diffusion within the nucleus (Supplementary Material). The core histone mobility was invariant across organisms, whether in mammalian cell lines or polytene chromosomes, suggesting similar evolutionarily conserved local chromatin architecture in these two systems. Because the histone proteins are released from the chromatin assembly either in transcription or replication, their ordered repacking is crucial to maintain epigenetic states. The possible existence of histones in their multimeric form and their local confined diffusion within the cell nucleus suggests higher fidelity of dynamic exchange of histones to maintain epigenetic memory (6).

View larger version (32K): [in this window] [in a new window]   FIGURE 6  Schematic model of the mobility of core (i) and linker (ii) histones within the cell nucleus. Core histones (H2B-EGFP) remain in the multimeric form (red) in normal physiological condition. Upon ATP depletion the multimeric core histones (H2B-EGFP) become monomeric (green). Linker histones diffuse through the chromosomal mesh structure by diffusion with interaction (red, interacting; green, noninteracting). For tailless linker histones the motion is purely diffusive and there is no interaction.

The mobility of histone proteins that are differentially associated with chromatin is also differentially affected upon induction of apoptosis. The highly interacting core histones become completely immobile in apoptotic nuclei, while the mobility of less interacting linker histones or noninteracting protein is only partially affected. The simulation results adequately describe our experimental findings that the nanoscale chromatin architecture defines the dynamics of core and linker histones within the cell nucleus. The differential binding timescales of core and linker histones, in addition to other chromatin binding proteins (such as high mobility group proteins (HMG) (32) and heterochromatin binding proteins HP1 (33)), perhaps provides an appropriate substrate for dynamic self-organization of regulatory information on DNA within living cells (34). Work in progress in our lab, using single molecule microscopy, is currently addressing the importance of histone dynamics in the context of their epigenetic states and their role in transcription control.

	ACKNOWLEDGEMENTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSIONS ACKNOWLEDGEMENTS REFERENCES

 
We thank Satyajit Mayor, Madan Rao, Apurva Sarin, and K. Vijay Raghavan for useful discussions and NCBS for the imaging facility funded by the Wellcome Trust. We also thank Yamuna Krishnan for critical reading of the manuscript.

Submitted on December 13, 2005; accepted for publication June 9, 2006.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSIONS ACKNOWLEDGEMENTS REFERENCES

 
1. Spector, D. L. 2003. The dynamics of chromosome organization and gene regulation. Annu. Rev. Biochem. 72:573–608.[CrossRef][Medline]

2. Schalch, T., S. Duda, D. F. Sargent, and T. J. Richmond. 2005. X-ray structure of a tetranucleosome and its implications for the chromatin fibre. Nature. 436:138–142.[CrossRef][Medline]

3. Zlatanova, J., P. Caiafa, and K. van Holde. 2000. Linker histone binding and displacement: versatile mechanism for transcriptional regulation. FASEB J. 14:1697–1704.[Abstract/Free Full Text]

4. Cosgrove, M. S., J. D. Boeke, and C. Wolberger. 2004. Regulated nucleosome mobility and the histone code. Nat. Struct. Mol. Biol. 11:1037–1043.[CrossRef][Medline]

5. Jenuwein, T., and C. D. Allis. 2001. Translating the histone code. Science. 293:1074–1080.[Abstract/Free Full Text]

6. Ahmad, K., and S. Henikoff. 2002. Epigenetic consequences of nucleosome dynamics. Cell. 111:281–284.[CrossRef][Medline]

7. Khorasanizadeh, S. 2004. The nucleosome: from genomic organization to genomic regulation. Cell. 116:259–272.[CrossRef][Medline]

8. Hansen, J. C. 2002. Conformational dynamics of the chromatin fiber in solution: determinants, mechanisms, and functions. Annu. Rev. Biophys. Biomol. Struct. 31:361–392.[CrossRef][Medline]

9. Becker, M., A. Becker, F. Miyara, Z. Han, M. Kihara, D. T. Brown, G. L. Hager, K. Latham, E. Y. Adashi, and T. Misteli. 2005. Differential in-vivo binding dynamics of somatic and oocyte-specific linker histones in oocytes and during ES cell nuclear transfer. Mol. Biol. Cell. 16:3887–3895.[Abstract/Free Full Text]

10. Bustin, M., F. Catez, and J. H. Lim. 2005. The dynamics of histone H1 function in chromatin. Mol. Cell. 17:617–620.[CrossRef][Medline]

11. Gasser, S. M. 2002. Visualizing chromatin dynamics in interphase nuclei. Science. 296:1412–1416.[Abstract/Free Full Text]

12. Kanda, T., K. F. Sullivan, and G. M. Wahi. 1998. Histone-GFP fusion protein enables sensitive analysis of chromosome dynamics in living mammalian cells. Curr. Biol. 8:377–385.[CrossRef][Medline]

13. Kimura, H., and P. Cook. 2001. Kinetics of core histones in living human cells: little exchange of H3 & H4 and some rapid exchange of H2B. J. Cell Biol. 153:1341–1353.[Abstract/Free Full Text]

14. Misteli, T., A. Gunjan, R. Hock, M. Bustin, and D. T. Brown. 2000. Dynamic binding of histone H1 to chromatin in living cells. Nature. 408:877–881.[CrossRef][Medline]

15. Lever, M. A., J. P. Th'ng, X. Sun, and M. J. Hendzel. 2000. Rapid exchange of histone H1.1 on chromatin in the living human cells. Nature. 408:873–876.[CrossRef][Medline]

16. Turner, B. M. 2002. Cellular memory and the histone code. Cell. 111:285–291.[CrossRef][Medline]

17. Thiriet, C., and J. J. Hayes. 2005. Replication-independent core histone dynamics at transcriptionally active loci in vivo. Genes Dev. 19:677–682.[Abstract/Free Full Text]

18. Bruno, M., A. Flaus, C. Stockdale, C. Rencurel, H. Ferreira, and T. O. Hughes. 2003. Histone H2A/H2B dimer exchange by ATP-dependent chromatin remodeling activities. Mol. Cell. 12:1599–1606.[CrossRef][Medline]

19. Th'ng, J. P., R. Sung, M. Ye, and M. J. Hendzel. 2005. H1 family histones in the nucleus: control of binding and localization by the c-terminal domain. J. Biol. Chem. 280:27809–27814.[Abstract/Free Full Text]

20. Contreras, A., and R. E. Herrera. 2003. The dynamic mobility of histone H1 is regulated by cyclin/CDK phosphorylation. Mol. Cell. Biol. 23:8626–8636.[Abstract/Free Full Text]

21. Marshall, W. F. 2002. Order and disorder in the nucleus. Curr. Biol. 12:185–192.[CrossRef]

22. Chen, Y., J. D. Muller, Q. Q. Ruan, and E. Gratton. 2002. Molecular brightness characterization of EGFP in vivo by fluorescence fluctuation spectroscopy. Biophys. J. 82:133–144.[Abstract/Free Full Text]

23. Koberna, K., D. Stanek, J. Malinsky, M. Eltsov, A. Pliss, V. Ctrnacta, S. Cermanova, and I. Raska. 1999. Nuclear organization studied with the help of a hypotonic shift: its use permits hydrophilic molecules to enter into living cells. Chromosoma. 108:325–335.[CrossRef][Medline]

24. Pardue, M. L. 1994. Looking at Polytene Chromosomes. Methods Cell Biol. 44:333–351.[Medline]

25. Mangenot, S., A. Leforestier, P. Vachette, D. Durand, and F. Livolant. 2002. Salt induced conformation and interaction changes of nucleosome core particles. Biophys. J. 82:345–356.[Abstract/Free Full Text]

26. Weiss, M., M. Elsner, F. Kartberg, and T. Nilsson. 2004. Anomalous subdiffusion is a measure for cytoplasmic crowding in living cells. Biophys. J. 87:3518–3524.[Abstract/Free Full Text]

27. Kimura, H. 2005. Histone dynamics in living cells revealed by photobleaching. DNA Repair. 4:939–950.[CrossRef][Medline]

28. Mangenot, S., S. Keller, and J. Radler. 2003. Transport of nucleosome core particles in semidilute DNA solutions. Biophys. J. 85:1817–1825.[Abstract/Free Full Text]

29. Weidemann, T., M. Wachsmuth, T. A. Knoch, G. Muller, W. Waldeck, and J. Langowski. 2003. Counting nucleosome in living cells with a combination of fluorescence correlation spectroscopy and confocal imaging. J. Mol. Biol. 334:229–240.[CrossRef][Medline]

30. Tomschik, M., H. Zheng, K. van Holde, J. Zlatanova, and S. H. Leuba. 2005. Fast, long-range, reversible conformational fluctuations in nucleosomes revealed by single-pair fluorescence resonance energy transfer. Proc. Natl. Acad. Sci. USA. 102:3278–3283.[Abstract/Free Full Text]

31. Li, G., M. Levitus, C. Bustamante, and J. Widom. 2005. Rapid spontaneous accessibility of nucleosomal DNA. Nat. Struct. Mol. Biol. 12:46–53.[CrossRef][Medline]

32. Phair, R. D., P. Scaffidi, C. Elbi, J. Vecerova, A. Dey, K. Ozato, D. T. Brown, G. Hager, M. Bustin, and T. Misteli. 2004. Global nature of dynamic protein-chromatin interactions in vivo: three-dimensional genome scanning and dynamic interaction networks of chromatin proteins. Mol. Cell. Biol. 24:6393–6402.[Abstract/Free Full Text]

33. Schmiedeberg, L., K. Weisshart, S. Diekmann, G. Meyer zu Hoerste, and P. Hemmerich. 2004. High and low-mobility populations of HP1 in heterochromatin of mammalian cells. Mol. Biol. Cell. 15:2819–2833.[Abstract/Free Full Text]

34. Gorski, S., and T. Misteli. 2005. Systems biology in the cell nucleus. J. Cell Sci. 118:4083–4092.[Abstract/Free Full Text]

35. Periasamy, N., and A. S. Verkman. 1998. Analysis of fluorophore diffusion by continuous distribution of diffusion coefficients: application to photo-bleaching measurements of multicomponent and anomalous diffusion. Biophys. J. 75:557–567.[Abstract/Free Full Text]

This article has been cited by other articles:

				A. Mazumder, T. Roopa, A. Basu, L. Mahadevan, and G. V. Shivashankar Dynamics of Chromatin Decondensation Reveals the Structural Integrity of a Mechanically Prestressed Nucleus Biophys. J., September 15, 2008; 95(6): 3028 - 3035. [Abstract] [Full Text] [PDF]

				J. P. Skinner, Y. Chen, and J. D. Muller Fluorescence Fluctuation Spectroscopy in the Presence of Immobile Fluorophores Biophys. J., March 15, 2008; 94(6): 2349 - 2360. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Supplement All Versions of this Article: biophysj.105.079343v1 91/6/2326    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bhattacharya, D. Articles by Shivashankar, G. V. Search for Related Content PubMed PubMed Citation Articles by Bhattacharya, D. Articles by Shivashankar, G. V.